ID: 1024822693

View in Genome Browser
Species Human (GRCh38)
Location 7:53351971-53351993
Sequence AAGCTTTAATAGATGGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024822689_1024822693 7 Left 1024822689 7:53351941-53351963 CCATTAACTCTTAAATATCAAGG No data
Right 1024822693 7:53351971-53351993 AAGCTTTAATAGATGGGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024822693 Original CRISPR AAGCTTTAATAGATGGGACA CGG Intergenic
No off target data available for this crispr