ID: 1024826922

View in Genome Browser
Species Human (GRCh38)
Location 7:53401114-53401136
Sequence CATGAGAGGGACTCGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024826922_1024826931 21 Left 1024826922 7:53401114-53401136 CCTTCCACCGAGTCCCTCTCATG No data
Right 1024826931 7:53401158-53401180 TGTGATTCAACATGAGATTTGGG 0: 3
1: 16
2: 410
3: 3221
4: 14048
1024826922_1024826930 20 Left 1024826922 7:53401114-53401136 CCTTCCACCGAGTCCCTCTCATG No data
Right 1024826930 7:53401157-53401179 CTGTGATTCAACATGAGATTTGG No data
1024826922_1024826929 -5 Left 1024826922 7:53401114-53401136 CCTTCCACCGAGTCCCTCTCATG No data
Right 1024826929 7:53401132-53401154 TCATGAGACGTAGGAATTGTGGG No data
1024826922_1024826928 -6 Left 1024826922 7:53401114-53401136 CCTTCCACCGAGTCCCTCTCATG No data
Right 1024826928 7:53401131-53401153 CTCATGAGACGTAGGAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024826922 Original CRISPR CATGAGAGGGACTCGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr