ID: 1024827170

View in Genome Browser
Species Human (GRCh38)
Location 7:53404194-53404216
Sequence TGGGCGTCCTTGGAAAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024827167_1024827170 -6 Left 1024827167 7:53404177-53404199 CCATGCAGACTAGGGCCTGGGCG No data
Right 1024827170 7:53404194-53404216 TGGGCGTCCTTGGAAAAAATAGG No data
1024827161_1024827170 20 Left 1024827161 7:53404151-53404173 CCTAGGTAGTACTTTGTGATGGT No data
Right 1024827170 7:53404194-53404216 TGGGCGTCCTTGGAAAAAATAGG No data
1024827166_1024827170 -5 Left 1024827166 7:53404176-53404198 CCCATGCAGACTAGGGCCTGGGC No data
Right 1024827170 7:53404194-53404216 TGGGCGTCCTTGGAAAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024827170 Original CRISPR TGGGCGTCCTTGGAAAAAAT AGG Intergenic
No off target data available for this crispr