ID: 1024829365

View in Genome Browser
Species Human (GRCh38)
Location 7:53430993-53431015
Sequence GAGTTACTTGGCTTTGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024829365_1024829371 21 Left 1024829365 7:53430993-53431015 CCATATTCAAAGCCAAGTAACTC No data
Right 1024829371 7:53431037-53431059 ACATGTTCTCACATAAAAGTGGG No data
1024829365_1024829372 24 Left 1024829365 7:53430993-53431015 CCATATTCAAAGCCAAGTAACTC No data
Right 1024829372 7:53431040-53431062 TGTTCTCACATAAAAGTGGGAGG No data
1024829365_1024829370 20 Left 1024829365 7:53430993-53431015 CCATATTCAAAGCCAAGTAACTC No data
Right 1024829370 7:53431036-53431058 CACATGTTCTCACATAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024829365 Original CRISPR GAGTTACTTGGCTTTGAATA TGG (reversed) Intergenic
No off target data available for this crispr