ID: 1024829368

View in Genome Browser
Species Human (GRCh38)
Location 7:53431005-53431027
Sequence TTTTCCATTCCTGAGTTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 4, 1: 3, 2: 7, 3: 34, 4: 375}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024829368_1024829371 9 Left 1024829368 7:53431005-53431027 CCAAGTAACTCAGGAATGGAAAA 0: 4
1: 3
2: 7
3: 34
4: 375
Right 1024829371 7:53431037-53431059 ACATGTTCTCACATAAAAGTGGG No data
1024829368_1024829370 8 Left 1024829368 7:53431005-53431027 CCAAGTAACTCAGGAATGGAAAA 0: 4
1: 3
2: 7
3: 34
4: 375
Right 1024829370 7:53431036-53431058 CACATGTTCTCACATAAAAGTGG No data
1024829368_1024829373 22 Left 1024829368 7:53431005-53431027 CCAAGTAACTCAGGAATGGAAAA 0: 4
1: 3
2: 7
3: 34
4: 375
Right 1024829373 7:53431050-53431072 TAAAAGTGGGAGGTAAGCTACGG No data
1024829368_1024829372 12 Left 1024829368 7:53431005-53431027 CCAAGTAACTCAGGAATGGAAAA 0: 4
1: 3
2: 7
3: 34
4: 375
Right 1024829372 7:53431040-53431062 TGTTCTCACATAAAAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024829368 Original CRISPR TTTTCCATTCCTGAGTTACT TGG (reversed) Intergenic
905249186 1:36637058-36637080 TTTTCTATTTCTGGGTTCCTTGG - Intergenic
907744780 1:57202156-57202178 TGTTTCATTACTGAGTTTCTGGG + Intronic
907755919 1:57310596-57310618 TTTTCCTTTCCAGAGTTGCTTGG - Intronic
908396672 1:63731364-63731386 ATTTCCATTCCTTTCTTACTGGG + Intergenic
908407158 1:63826349-63826371 TTTTCTATTCCTGAGTTAGTTGG + Intronic
908853745 1:68399621-68399643 TTTTCCTATTTTGAGTTACTAGG + Intergenic
910298290 1:85675544-85675566 TTTACCATTCCAGAGATCCTAGG - Intronic
911043560 1:93610344-93610366 TTTTCTATCTCTGAGCTACTGGG + Intronic
912121982 1:106482469-106482491 TTTTCCATTCCTGAGTTACTTGG - Intergenic
912125282 1:106529838-106529860 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
912239931 1:107895638-107895660 TTTTTCTTTCCTGTGTCACTGGG - Intronic
913460429 1:119080452-119080474 TTTTCCATTCTCTAGTTCCTGGG + Intronic
916809410 1:168292389-168292411 TTTGCCATTCTTTAGTCACTTGG + Intronic
917330054 1:173871231-173871253 TTTTCCTTACCTGATTTTCTTGG + Intronic
917389938 1:174524505-174524527 TTTTTCATTCTTGAGTTCCTTGG + Intronic
917544892 1:175954186-175954208 ATTTCCATCCCTGGGTTATTTGG - Intronic
917602133 1:176586548-176586570 TTTTCTGTTCCTGTGTTAGTTGG + Intronic
919877696 1:201882537-201882559 TTTTCCTTTTTTGAGTAACTGGG + Exonic
920125359 1:203690001-203690023 TTTTGCCTTCCTTAATTACTGGG + Intronic
921213875 1:212921321-212921343 GTTTGCATTCCTAAGTTCCTTGG + Intergenic
923570243 1:235107199-235107221 ATTTCCATTCATTATTTACTAGG + Intergenic
924865397 1:247974164-247974186 TTTTCTATTCCTGTGTTAGTTGG - Intronic
1062854227 10:771691-771713 TTTTCTGTTCCTGCGTTAGTTGG - Intergenic
1063413317 10:5853386-5853408 TTTCCCTTGGCTGAGTTACTGGG - Intergenic
1063725224 10:8629745-8629767 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
1063861000 10:10307599-10307621 TTTCCCATTCCAGAGATTCTTGG + Intergenic
1066035500 10:31478146-31478168 TTTTCTCTTGCTGAGTTATTTGG - Intronic
1066525682 10:36276634-36276656 TTTTCTTTTCCTGTGTTAGTCGG - Intergenic
1066574377 10:36809553-36809575 TTTAAAATTCCTGATTTACTGGG - Intergenic
1067179597 10:43974566-43974588 TTTCCCATTGCTGTGTTACAAGG - Intergenic
1068092079 10:52444592-52444614 GTTTCCATTACTGGCTTACTAGG + Intergenic
1068161348 10:53269184-53269206 TTTTCCATTCCTGTGTTAGTTGG - Intergenic
1068361834 10:55984920-55984942 TTTTCCATACCTGAGCAACTAGG - Intergenic
1068777674 10:60885710-60885732 TTTTCCCTTTCTGAACTACTGGG + Intronic
1068859546 10:61833366-61833388 TTGTCCATTCCTCAGTTGATGGG + Intergenic
1068999444 10:63247233-63247255 TTTTCCATTTCTAATTTATTTGG - Intronic
1070053978 10:72916431-72916453 TTTTCTGTTCCTGTGTTAGTTGG + Intronic
1070719121 10:78744360-78744382 TTTTCCATTTCTAAGACACTGGG + Intergenic
1071500608 10:86201413-86201435 TTTTCTGTTCCTGTGTTAGTTGG - Intronic
1071720619 10:88140667-88140689 TCTTCCATTGCTGAATTCCTGGG - Intergenic
1072006219 10:91251123-91251145 ATTTCCATTGCTGAGTTGGTTGG + Intronic
1073201408 10:101738760-101738782 TCTTCCCCTCCTGAGTAACTGGG + Intergenic
1073435505 10:103513551-103513573 CTCTCCATTCCTGAGGCACTAGG - Intronic
1073788840 10:106919335-106919357 TTTTCCATTTAAGAGTCACTGGG - Intronic
1073936231 10:108635668-108635690 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
1074635836 10:115316214-115316236 TTTTCTGTTCCTGTGTTAGTTGG + Intronic
1076728690 10:132426593-132426615 TCTACCATTCATGATTTACTTGG + Intergenic
1079242637 11:18731584-18731606 TTCTCAAGTCCTGAGTTACCTGG + Intronic
1079553695 11:21733071-21733093 TTTTCCCTTGCTGAGTTCTTCGG - Intergenic
1081431545 11:42982168-42982190 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
1085190377 11:74615422-74615444 TTTTCACTTCCTAACTTACTTGG - Intronic
1085645309 11:78218760-78218782 TTTTTCATTCCTGTTTTTCTTGG - Exonic
1086611593 11:88762905-88762927 TTTTCTGTTCCTGTGTTAGTTGG - Intronic
1088034197 11:105292064-105292086 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
1088855897 11:113753282-113753304 TTTTCTGTTCCTGAGTTGGTTGG + Intronic
1088906534 11:114159298-114159320 CTTTCCATGCCTGTCTTACTGGG + Intronic
1090972434 11:131654940-131654962 TTTTTCATTTCTGAGTAGCTGGG - Intronic
1091365027 11:135011435-135011457 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
1092100157 12:5876713-5876735 TTTTCTGTTCCTGTGTTAGTTGG - Intronic
1092337008 12:7642088-7642110 TTTTCATCTCCTGAGTTATTGGG - Intergenic
1092787282 12:12038582-12038604 TCTTCCCTTCCTGAGATACGTGG + Intergenic
1093011627 12:14113195-14113217 TGTTCCCTTCCTGAATGACTTGG + Intergenic
1093352539 12:18121306-18121328 TTTTCTTTTCCTTTGTTACTAGG - Intronic
1093437634 12:19154440-19154462 TTATCCATTGCTGAGTATCTTGG - Intronic
1093451130 12:19315841-19315863 GTATCCATTCCTCAGTTACATGG - Intronic
1093796531 12:23320011-23320033 TTTTCCATTCATTTGTTAATGGG - Intergenic
1095901258 12:47330874-47330896 TTTCCTATACATGAGTTACTAGG + Intergenic
1096446816 12:51700378-51700400 TTTTCCCTAGCTGAGTTACTTGG + Intronic
1096677487 12:53233488-53233510 TTTTCCATACTGGAATTACTTGG + Intergenic
1099455854 12:82862003-82862025 AATTTCATTCCTGAGTTAGTGGG + Intronic
1099924380 12:88999801-88999823 TTTGCCATTTGTGAGTTTCTAGG + Intergenic
1100881526 12:99023175-99023197 TTTTTCATTCTTGATTTACATGG + Intronic
1102568233 12:113811218-113811240 TTTTCTGTTCCTGTGTTATTTGG + Intergenic
1106029683 13:25988707-25988729 TATTCCTTTCTTGAGCTACTTGG - Intronic
1106822171 13:33477470-33477492 GTTTACATTCCTCAGTTCCTTGG - Intergenic
1107223415 13:38015710-38015732 TTTTCCTTTCCTGATTTCATTGG + Intergenic
1108646790 13:52438164-52438186 TTTTCCTTTCCTGTGTTCCAAGG - Intronic
1108857406 13:54811518-54811540 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
1108858615 13:54826249-54826271 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
1109004696 13:56857366-56857388 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
1109506940 13:63313957-63313979 TTTTTTGTTTCTGAGTTACTGGG + Intergenic
1109714166 13:66199443-66199465 TTTTCTGTTCCTGTGTTAATTGG - Intergenic
1109955884 13:69565434-69565456 TTTTCCATTTCTGAGTCTGTGGG + Intergenic
1110290621 13:73802726-73802748 TTTTCTGTTCCTGGGTTAATTGG + Intronic
1110304923 13:73975339-73975361 TTTTCCACACCTGATTTTCTTGG + Intronic
1110554451 13:76842895-76842917 TTGTCATTTCCTGAGTGACTTGG - Intergenic
1110625974 13:77656259-77656281 TTGGCTATTCCTGGGTTACTTGG + Intergenic
1110703829 13:78581100-78581122 TTTTTTGTTCCTGAGTTCCTTGG + Intergenic
1111621781 13:90733607-90733629 TTATACATTCCTGGGTTGCTTGG - Intergenic
1111669839 13:91316777-91316799 TATTCTATTCCTCTGTTACTTGG - Intergenic
1111861874 13:93717866-93717888 TTTTCTGTTCCTGTGTTAGTTGG + Intronic
1112043107 13:95568156-95568178 TACTCCATTCATGAGTTATTTGG + Intronic
1113002568 13:105659491-105659513 TTATCCATTCATTAGTTGCTGGG - Intergenic
1113589620 13:111489214-111489236 TCTGGCATTTCTGAGTTACTGGG + Intergenic
1113858350 13:113462701-113462723 TGTTCCATATCTCAGTTACTTGG - Intronic
1114357526 14:21928134-21928156 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
1114848790 14:26357558-26357580 TTATCCATTCATCAGTTAATGGG + Intergenic
1115121068 14:29938857-29938879 TTTTCCAGTCCTTTGTTAATTGG + Intronic
1115928313 14:38462321-38462343 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
1115938737 14:38584906-38584928 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
1115970342 14:38938623-38938645 TTTTCCATTCCTGAGTTACTTGG - Intergenic
1116123201 14:40747914-40747936 TTTTACTATCCTGAGTCACTTGG + Intergenic
1116360861 14:43996315-43996337 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
1117033490 14:51701977-51701999 ATTACTATTCCTGACTTACTAGG - Intronic
1117965234 14:61200453-61200475 TTTTCTATTCCTCAGATACCTGG - Intronic
1119453832 14:74737028-74737050 TCTTCCATTCCTAATTTACTGGG - Exonic
1120131444 14:80812158-80812180 TTTTCTGTTCCTGAGTTAATTGG + Intronic
1120411667 14:84164921-84164943 TATTCCAGCCCTGTGTTACTGGG + Intergenic
1121030400 14:90653796-90653818 TTTTCCATTCTTGGGTCAGTTGG - Intronic
1121465614 14:94113767-94113789 TTATCCATTCCTGATTCCCTGGG + Intronic
1121780158 14:96617114-96617136 TTTGCCATTACTGTGTGACTTGG + Intergenic
1122246801 14:100408923-100408945 TTTTCCATTACAGTGTTATTAGG + Intronic
1122630123 14:103103933-103103955 TCTTCCAGTCCTGACTTCCTGGG + Exonic
1122837955 14:104440063-104440085 TTTACCATTCCTGAAATCCTAGG - Intergenic
1123013732 14:105363155-105363177 TTTACCATTCCTGAAATCCTAGG - Intronic
1123203980 14:106694355-106694377 TTATCCATTCATGTGTTAATCGG + Intergenic
1123209011 14:106740860-106740882 TTATCCATTCATGTGTTAATCGG + Intergenic
1202941838 14_KI270725v1_random:156355-156377 TTCTCCATTCCTGAGCAAGTTGG - Intergenic
1125202888 15:37116609-37116631 TTTTTCATTCCACTGTTACTGGG + Intergenic
1125329468 15:38567871-38567893 TTTTCCATTCCTGTGTTAGTTGG + Intergenic
1126214572 15:46139985-46140007 TTTTCTCTTTGTGAGTTACTTGG - Intergenic
1127167622 15:56263471-56263493 TTTTCCTTTCCTAATTTTCTTGG + Intronic
1127615563 15:60682088-60682110 TTTTCTAGTCCTGAATTTCTTGG + Intronic
1128681979 15:69659039-69659061 TTCTCCATTTCTGCCTTACTAGG + Intergenic
1129925641 15:79361446-79361468 TTTTCCATTCCTGAGTTACCCGG - Intronic
1130547424 15:84867438-84867460 TTCTCCATCCCTGAGGTGCTGGG + Intronic
1130663697 15:85851677-85851699 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
1131633038 15:94199787-94199809 TTTTCCTTTCCTCTGTGACTGGG + Intergenic
1133489929 16:6257680-6257702 TTTTCTATTCCTGCATTAGTTGG + Intronic
1133904846 16:10012747-10012769 TTTTCCTTGCCTGATTTCCTTGG - Intronic
1135433320 16:22406121-22406143 TTTTCTCTTCCTGAGTTGCAAGG + Intronic
1138705569 16:58911871-58911893 TTTTCTTTTCCTGATTTTCTTGG + Intergenic
1139118790 16:63989477-63989499 TACTCCACTCATGAGTTACTGGG - Intergenic
1140807924 16:78550766-78550788 TTTTCCATCCTTGAATAACTTGG + Intronic
1141392973 16:83680216-83680238 TTTTCCATTCTAGTGTCACTCGG + Intronic
1141748785 16:85944513-85944535 TTTTCCATTGCAGAGAGACTTGG + Intergenic
1141983839 16:87566712-87566734 TGTGCCATTCCTGGGTTAATGGG + Intergenic
1144994062 17:19254769-19254791 TTCCCCACTCCTGAGTTACAGGG + Intronic
1146592469 17:34139483-34139505 TTATCCATTCATCAGTTAGTGGG - Intronic
1148043529 17:44727529-44727551 TTCTGCAGTCCTGAGTTTCTGGG - Intronic
1148640029 17:49180527-49180549 TTTTCCTTTCCTGGGTTAAGCGG - Intergenic
1149553382 17:57556269-57556291 TTTTCCCCTCCTGATTTCCTTGG + Intronic
1149588373 17:57809065-57809087 TTTTCTGTTCCTGCGTTAATTGG - Intergenic
1149992926 17:61392825-61392847 GTGTCCATCCCTGAGTTGCTGGG + Exonic
1150089108 17:62305230-62305252 TTTTCCATTCCTGAGGTACTTGG + Intergenic
1150856689 17:68759947-68759969 TTTCCCATTGCTGAGTCACTGGG + Intergenic
1150935883 17:69635112-69635134 ATTTCCATTTAAGAGTTACTTGG + Intergenic
1151791953 17:76311700-76311722 TTTTCCATCACTGTGTGACTAGG - Exonic
1153707821 18:7764665-7764687 ATTTGCATTTCTGAGTTCCTAGG + Intronic
1155329009 18:24695368-24695390 TTTTCCATTCCTGCATGCCTTGG + Intergenic
1155334835 18:24752980-24753002 TTTTTCATTCCTGAGTCCCATGG + Intergenic
1155799566 18:30083527-30083549 TTTTCCATTCATGAGTTAAATGG - Intergenic
1156196365 18:34778120-34778142 TTTTCTTTTCCTAAGTTATTTGG + Intronic
1156751541 18:40463520-40463542 CTTTCTATTCCTGTGTTAATTGG + Intergenic
1157911574 18:51622032-51622054 TTTTCCAGTCCTGCCTTGCTGGG + Intergenic
1158313776 18:56188414-56188436 TTTTCCTCTCCTAAGTCACTTGG + Intergenic
1158794039 18:60819918-60819940 TTGTCAATTCCTGAGTCATTTGG + Intergenic
1159413859 18:68118279-68118301 TTTTCCATTCCATTGTTAATTGG + Intergenic
1159692807 18:71511335-71511357 TTTTCTATTCCTAACCTACTAGG - Intergenic
1160138189 18:76292952-76292974 TTTTCCATCTCTGATTTATTTGG + Intergenic
1160239240 18:77111397-77111419 TTTTCCTTTCCTGGGATACTGGG - Intronic
1160441093 18:78893244-78893266 TTATCCATTCATGAGTTGATGGG - Intergenic
1160911761 19:1477520-1477542 TTGTCCACTCCTGATTTACGAGG - Intronic
1164712440 19:30367097-30367119 TTTTCCATTTCTCACTTGCTAGG + Intronic
1164849848 19:31472403-31472425 TTTTCTATTCTCGAGTGACTTGG + Intergenic
1165037020 19:33041157-33041179 ATTTCCATTCCTGCATTTCTGGG + Intronic
1165819735 19:38666801-38666823 GTTTCCATTCTTGACTTAGTGGG + Intronic
1166310520 19:41959793-41959815 ATTTCCATTTCTGAGTTCCCAGG + Intergenic
1166820122 19:45574045-45574067 TTTTGCCTTCCTGAGTAGCTGGG - Intronic
1167158086 19:47751277-47751299 TTTTCCTTTCCTGAGTTGTGAGG + Intronic
1167725052 19:51205912-51205934 TTATCCATTTGTCAGTTACTGGG - Intergenic
924968264 2:99116-99138 TTTTCTGTTCTTGTGTTACTTGG - Intergenic
927001210 2:18795811-18795833 TTTTGCAATCCTGAGCTACCAGG - Intergenic
928159489 2:28908983-28909005 TTTTCATTTCATTAGTTACTAGG + Intronic
928610217 2:32985240-32985262 TTTTCCTTTGCTGAGTGACATGG + Intronic
928656189 2:33454339-33454361 TTCTCCTTTCCTTAGTTACAGGG - Intronic
929304511 2:40345729-40345751 TTTTCTGTTCCTGTGTTAGTTGG - Intronic
929313270 2:40450194-40450216 CTTTCAAATCCTGTGTTACTTGG - Intronic
930049012 2:47199388-47199410 TTATCCATTCCTGGCTGACTGGG - Intergenic
931505829 2:62924495-62924517 TTTTTCATTTCTGATTTATTTGG - Intronic
933105570 2:78320780-78320802 TTTTTGATTCATGAGTTATTCGG - Intergenic
933173316 2:79149370-79149392 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
933822505 2:86126532-86126554 GTTTCTATTCTTAAGTTACTAGG - Intronic
934148870 2:89125203-89125225 TTTTCCATTTCTAATTTTCTAGG + Intergenic
934218428 2:90056843-90056865 TTTTCCATTTCTAATTTTCTAGG - Intergenic
934555555 2:95285298-95285320 TTGTCCATTCCTGTGTGACCGGG - Intronic
934890750 2:98066955-98066977 TGTTCCACTCCTGAGCCACTTGG - Intergenic
935006768 2:99086732-99086754 TTTTTCTTTCCTTATTTACTTGG - Intronic
935573673 2:104687851-104687873 TTTTTCCTTCCTGCGTTGCTAGG - Intergenic
936985754 2:118310392-118310414 TTTTCATTTCCTGTGTTACGGGG - Intergenic
937137667 2:119568596-119568618 TTTTCTGTTCCTGTGTTAGTTGG + Intronic
937708767 2:124953011-124953033 TTTCCCCTTCCTGCGGTACTAGG + Intergenic
937735331 2:125281017-125281039 TATTGGATTCCTGCGTTACTTGG + Intergenic
938081029 2:128370235-128370257 TTTTCCTTCCCTGAGATTCTGGG - Intergenic
938259368 2:129884316-129884338 TTTTCCACTCCTCAGGTACAGGG + Intergenic
938640477 2:133272938-133272960 TTATCCATTCATCAGTTAATGGG + Intronic
940089069 2:149896025-149896047 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
940090715 2:149913535-149913557 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
941643144 2:168010868-168010890 ATTTACATTCCAAAGTTACTAGG + Intronic
942142912 2:172995875-172995897 TTTCCCATTCATGATCTACTGGG + Intronic
943946807 2:194075672-194075694 TTTTTCATTCCTGATTTTCATGG + Intergenic
944154476 2:196595070-196595092 TTTTCTGTTCCTGTGTTAGTGGG - Intergenic
944326904 2:198416941-198416963 TTTTCCATTCATGTTTTAGTTGG + Intronic
944603622 2:201329676-201329698 TTTTCTGTTCCTGTGTTAATTGG - Intronic
945475426 2:210276364-210276386 TTTCCCATTGCTGAGTTACTGGG + Intergenic
945623184 2:212168210-212168232 TTTTGCATTCCTAAATTCCTGGG + Intronic
946264368 2:218525945-218525967 TTTTCTGTTCCTGTGTTAGTTGG + Intronic
947234670 2:227927790-227927812 TTTACCATTCCTGAAATCCTAGG + Intergenic
947858216 2:233338812-233338834 TTTTCCTTTCCTGAATGACTGGG + Intronic
1169154532 20:3318363-3318385 TATGACATTCCTGACTTACTGGG - Exonic
1170268317 20:14494683-14494705 TGTTCTATTACTTAGTTACTTGG - Intronic
1172642596 20:36449735-36449757 TAGTCCATTCATGAGTGACTGGG - Intronic
1173530491 20:43766062-43766084 TTCTGCATTTCTGAGATACTGGG + Intergenic
1174663529 20:52236210-52236232 TTTTCCATCTCTGAGTCACTAGG - Intergenic
1176581325 21:8530580-8530602 TTCTCCATTCCTGAGCAAGTTGG + Intergenic
1176994652 21:15541467-15541489 TTTTCCGTTCCTGTGTTAGTTGG - Intergenic
1177009831 21:15718605-15718627 TTTTCTGTTCCTGCGTTAGTTGG - Intergenic
1177032649 21:16001362-16001384 TTTTCTCTTCCTGTGTTAGTTGG - Intergenic
1177191677 21:17858905-17858927 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
1178754553 21:35336240-35336262 TTTCCCTTTCCTGGGTGACTTGG - Intronic
1182953352 22:34397855-34397877 TTTTCCTTTCCTGTGTTGTTAGG - Intergenic
1185204034 22:49526822-49526844 TTTTCCTTTCCTGAATTTCTTGG + Intronic
949173403 3:1030176-1030198 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
950607691 3:14097575-14097597 TTCTCCATCCCTCAGTTCCTGGG + Intergenic
951859723 3:27238363-27238385 TTTTCCATTTCTGGGTTAGTAGG + Intronic
952555969 3:34531763-34531785 TTTTGCATTCCTTTGTTGCTGGG + Intergenic
953173737 3:40530350-40530372 TTTTGCCTTCCTGGTTTACTAGG + Intronic
955499187 3:59567125-59567147 TTTTCTTTTCCTGTGTTAGTTGG + Intergenic
955801254 3:62689030-62689052 TTTTCACTTCCTTTGTTACTAGG + Intronic
955918160 3:63926921-63926943 TTTTCTGTTCCTGTGTTAGTTGG + Intronic
955998507 3:64703407-64703429 TGTTGAATTTCTGAGTTACTAGG - Intergenic
956116047 3:65919945-65919967 TATTTCATTCCTGAGTTTCCAGG - Intronic
957764789 3:84609440-84609462 ATTTCCATTTCTGAGATATTTGG + Intergenic
958173981 3:89972016-89972038 TTTTCTGTTCCTGTGTTAATTGG - Intergenic
958610703 3:96421545-96421567 TTGTACATTCCTGAATTAGTTGG - Intergenic
959133822 3:102391862-102391884 TTTTCCATTCCTCTGTAACAGGG + Intronic
960055002 3:113270889-113270911 TTTTCACTTCCTGGGTCACTGGG - Exonic
960156736 3:114304355-114304377 TTTGCCATTTCTGATTTAGTAGG + Intronic
962121955 3:132570767-132570789 TTTTCTGTTCCTGCGTTAGTTGG + Intronic
962140511 3:132785410-132785432 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
962931564 3:140042463-140042485 TTTTCCATTCATCAGTTGATGGG + Intronic
965017568 3:163177590-163177612 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
965102940 3:164326114-164326136 ATTTGCATTCATGAGTTATTAGG - Intergenic
967387468 3:188925781-188925803 TTTTCCATTTCTAACTTTCTAGG - Intergenic
967846097 3:194044344-194044366 TTTTCCTTTCCCCAGTTATTGGG - Intergenic
967878911 3:194285347-194285369 TTTTCCTTTCCTGTGTTACAGGG - Intergenic
967905860 3:194499387-194499409 TTTTTGATTCCTGAGATACTTGG + Intergenic
969070387 4:4533121-4533143 CTTTCCATATCTGAGTTATTGGG + Intronic
970498602 4:16653602-16653624 TTTTCTGTTCCTGAACTACTCGG - Intronic
971660226 4:29404847-29404869 TTGTCCAGTCCTGAGTTAACTGG - Intergenic
972618059 4:40719302-40719324 TTTTCCATTCTTGGGGTATTTGG - Intergenic
973570076 4:52229737-52229759 TCTCCCATTCCTGAGTTTCTGGG - Intergenic
974312883 4:60234801-60234823 TTTTGCATGCCTCAGCTACTTGG - Intergenic
974317504 4:60301253-60301275 TTATCCATTCATCAGTTAATGGG - Intergenic
974824201 4:67105574-67105596 TTTTGCATGACTGAATTACTTGG + Intergenic
975434873 4:74340559-74340581 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
975773279 4:77753924-77753946 TTTTCTATTCCTGGTTTGCTAGG - Intronic
976191285 4:82489421-82489443 TTTTCCTTTCCAGGTTTACTAGG + Intronic
976455081 4:85237083-85237105 TTCTCCATGTTTGAGTTACTAGG + Intergenic
976931298 4:90570015-90570037 CTTTCCAGTCCTGAGGAACTGGG - Intronic
977812721 4:101376018-101376040 TTTTCCTTTCTTGAATTTCTTGG - Intergenic
978003219 4:103582706-103582728 TTATCCATTCATGAGTTGATAGG + Intergenic
978240825 4:106514343-106514365 GGTTCCATTACTGATTTACTCGG - Intergenic
978298512 4:107237607-107237629 TTATCCATTCATCAGTTAATGGG + Intronic
978614253 4:110577950-110577972 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
979140980 4:117174375-117174397 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
980539080 4:134170144-134170166 TTTTCTGTTCCTGCATTACTTGG + Intergenic
980568350 4:134576006-134576028 TTTTCCTTTTGTGAGTTATTTGG + Intergenic
981021912 4:140038480-140038502 TTTTCCTTCCCTGACTTCCTAGG + Intronic
982967822 4:161936596-161936618 TTTTCATTTCCTGCGGTACTTGG - Intronic
982986593 4:162216397-162216419 TTTTGTATTGCTGAGTTACTAGG - Intergenic
983320869 4:166194960-166194982 TTATCCATTCATGAGTTGATGGG + Intergenic
984394774 4:179182083-179182105 TTTTCCTTTCCAGGTTTACTGGG + Intergenic
984757137 4:183335611-183335633 CTTTCCATTCCTGACATAGTTGG + Intergenic
984831612 4:183980748-183980770 CTTTTCATTCCTCAGTTAATTGG + Intronic
985835102 5:2264795-2264817 TTTTCTGTTCCTGTGTTACTTGG - Intergenic
985877891 5:2613904-2613926 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
987501230 5:18711871-18711893 TTTTCCGTTCCTGTTTTAGTTGG - Intergenic
987537505 5:19207400-19207422 TCTTCCTTTCCTGAGCTACCTGG - Intergenic
987554625 5:19431136-19431158 TTTACCACTCCTGAGTTACTTGG + Intergenic
987711920 5:21511616-21511638 TTTTCTGTTCCTGCGTTAGTGGG - Intergenic
988302490 5:29449167-29449189 TTTTCTGTTCCTGCGTTAGTGGG + Intergenic
988325074 5:29754369-29754391 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
988654336 5:33191605-33191627 TATTCCATTCCTGAATTCATGGG + Intergenic
988690464 5:33566890-33566912 TTTTCCCTTTCTGATTGACTGGG + Intronic
989480888 5:41928768-41928790 TTTCCCCTTCATGAGTTACAAGG + Intronic
989532158 5:42520518-42520540 TTTTCCAGTCCTGAGAAATTTGG - Intronic
990309392 5:54523696-54523718 TATACCATTCCTGAGGTCCTGGG - Intronic
991051997 5:62282906-62282928 ATTTCCTTTGCTGAGTTGCTGGG - Intergenic
991762280 5:69930755-69930777 TTTTCTGTTCCTGCGTTAGTGGG - Intergenic
991779194 5:70115974-70115996 TTTTCTTTTCCTGACTTCCTAGG - Intergenic
991785047 5:70187350-70187372 TTTTCTGTTCCTGCGTTAGTGGG + Intergenic
991841508 5:70805804-70805826 TTTTCTGTTCCTGCGTTAGTGGG - Intergenic
991858486 5:70991447-70991469 TTTTCTTTTCCTGACTTCCTAGG - Intronic
991871644 5:71116330-71116352 TTTTCTTTTCCTGACTTCCTAGG - Intergenic
991877494 5:71187742-71187764 TTTTCTGTTCCTGCGTTAGTGGG + Intergenic
992054091 5:72970367-72970389 CTTTCCACTCCAGAGATACTGGG + Intronic
992179119 5:74179536-74179558 TTTTCCATTCCTGACCATCTTGG - Intergenic
993113337 5:83686899-83686921 TTCTCCATTCCTGAATTTCAAGG + Intronic
993638963 5:90379868-90379890 TTTCCCATTCCTGAGAGAGTGGG + Intergenic
993693929 5:91037441-91037463 TTTTCCCTTCCTGACTTGATGGG - Intronic
993860159 5:93125896-93125918 TTTTTCCTTACTGAGTTGCTGGG - Intergenic
994685591 5:102947409-102947431 TTTTCCATTCCTGAGTTACTCGG - Intronic
995284710 5:110374635-110374657 TTTTCTGTTCCTGAGTTAGTTGG + Intronic
996863118 5:128087234-128087256 TTCTCCATTTATGAGTTATTGGG + Intronic
996917417 5:128728961-128728983 TTTTCTGTTCCTGTGTAACTTGG + Intronic
997815023 5:137008356-137008378 TTTACCTCTCCTAAGTTACTTGG - Intronic
998607781 5:143653045-143653067 TTTTGTATTCCTGATTTAATAGG - Intergenic
998708380 5:144791674-144791696 TTATCCACTCATCAGTTACTGGG + Intergenic
999018870 5:148141082-148141104 TCATCCATTACTGAGTTAGTTGG - Intergenic
999424462 5:151475195-151475217 CTTTCCAGTCCTGAGTTCTTGGG - Intronic
999452096 5:151686188-151686210 TGTTCCTGTCCTGAGTTCCTTGG - Intronic
999635718 5:153619981-153620003 CTTTCCATTCCTGACATTCTAGG + Intronic
999861587 5:155653354-155653376 TTTTCTGTTCCTGTGTTAATTGG + Intergenic
999937050 5:156498655-156498677 TTATCCATTCATCAGTTAATAGG + Intronic
1001054753 5:168439978-168440000 TGTTCAGTTCCTGAGTTCCTTGG + Intronic
1001532471 5:172473342-172473364 TTTTTCATTCCTAAGTAGCTGGG - Intergenic
1001754506 5:174158160-174158182 TTTTCTGTTCCTGCGTTAGTTGG - Intronic
1003799770 6:9650650-9650672 TTTTCCATTTCTTAGTGACATGG + Intronic
1003973534 6:11322061-11322083 TTTTCTGTTCCTGGGTTAATTGG - Intronic
1005687209 6:28266158-28266180 TTTTCTGTTCCTGTGTTAATTGG + Intergenic
1006327788 6:33366709-33366731 TTATCCATTCATCAGTTAGTGGG + Intergenic
1007526475 6:42499278-42499300 TGTCCCATTCCTGAGGTAATAGG + Intergenic
1008203092 6:48616803-48616825 TTTTCCGTTCCTGTATTAGTAGG + Intergenic
1008974824 6:57412662-57412684 TTTTCATTTCTTTAGTTACTTGG + Intronic
1009024618 6:57983825-57983847 TTTTCCAATCCAGAGTCATTAGG - Intergenic
1009163710 6:60314168-60314190 TTTTCATTTCTTTAGTTACTTGG + Intergenic
1009814823 6:68719166-68719188 TTTTCTATTCCTGCCTTAGTTGG + Intronic
1010799967 6:80163780-80163802 TTTTCCCTTTCTCAGTTACTGGG + Intronic
1012473807 6:99599976-99599998 TTTTCCATTCATTAGTTAATAGG - Intergenic
1013304571 6:108836598-108836620 TATTCCATCCAAGAGTTACTGGG - Intergenic
1013346451 6:109265175-109265197 TCTTTCATTTCTCAGTTACTTGG - Intergenic
1014316291 6:119869512-119869534 TTTTTCATTCATGAGTGACCTGG + Intergenic
1016168245 6:140974926-140974948 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
1017342069 6:153335741-153335763 TTTTCCAATCCAGAGTTGATGGG + Intergenic
1019896212 7:3985223-3985245 TTTTAGTTTCCTGAGTGACTGGG - Intronic
1020394376 7:7697545-7697567 TTCTTCCTTCCTGAGATACTTGG - Intronic
1020801253 7:12734867-12734889 TTTCTCATTCCTGAGTGAATTGG + Intergenic
1021018877 7:15571210-15571232 TTTTCCCTTTCTGATTTAATTGG + Intergenic
1022205919 7:28163500-28163522 TTCTCAATTCCTGAGCTGCTTGG - Intronic
1022413524 7:30158132-30158154 TTTGCCATTACTGAGTTACCTGG + Exonic
1023273139 7:38488409-38488431 TTTTCTGTTCCTGTGTTAGTTGG - Intronic
1024282285 7:47729325-47729347 TTTTCCATTCATCAGTTGATGGG + Intronic
1024829368 7:53431005-53431027 TTTTCCATTCCTGAGTTACTTGG - Intergenic
1025082375 7:55994997-55995019 TTTTCCCTTTTCGAGTTACTGGG + Intronic
1026649487 7:72203071-72203093 TTTTCTGTTCCTGTGTTAGTTGG - Intronic
1026652733 7:72229667-72229689 TTTTCTGTTCCTGTGTTAGTTGG - Intronic
1026661820 7:72309390-72309412 GGGTCCATTCCTGAGTTCCTTGG - Intronic
1026836739 7:73644753-73644775 TTTTCCATCCCTGAGTCCCCTGG - Intergenic
1031696391 7:124860863-124860885 TTTTCCGTTCTTGTGTTAGTTGG + Intronic
1031771785 7:125852801-125852823 TTTTAAATTTCTGAGTTACCCGG - Intergenic
1032289236 7:130572606-130572628 TTCTTGATCCCTGAGTTACTTGG - Intronic
1032415250 7:131730527-131730549 TTTTCCATTTCTATGTTAATTGG + Intergenic
1032573431 7:133026629-133026651 TTGTCCATTCATCAGTTGCTAGG - Intronic
1033832518 7:145271000-145271022 TTTTCAATTCCTGAATCACCCGG + Intergenic
1033866439 7:145696296-145696318 ATTTCCATTCCAGAGTTGCCAGG - Intergenic
1034376654 7:150650735-150650757 TTTTCCATTCCTGAATTACTTGG + Intergenic
1035339304 7:158150329-158150351 TGTTCCATTTCTGAGTACCTGGG + Intronic
1035584356 8:760565-760587 TTTTCCTTTCCTGAGTTTGTCGG + Intergenic
1036095743 8:5723774-5723796 TATTCCATTCCTAAGTAACGGGG + Intergenic
1037106287 8:15111942-15111964 TATTTCATTCCTTCGTTACTTGG + Intronic
1038866851 8:31448076-31448098 TCTTCCATTCCTAGGTTAATGGG - Intergenic
1039307074 8:36274347-36274369 TATTCCAACCCTGAGTTACATGG + Intergenic
1039490506 8:37944020-37944042 TTTTCCTTTCCTGAATTCCCTGG + Intergenic
1039685398 8:39796297-39796319 TTTTCTGTTCCTGTGTTAGTTGG + Intronic
1039833306 8:41235383-41235405 ATTTCCAATCCTGAGGTTCTAGG - Intergenic
1041520543 8:58751200-58751222 TTTATGATTCCTGAGTTACAGGG + Intergenic
1041765765 8:61416710-61416732 TTTTCCATTCTTGCATTACTAGG - Intronic
1042401182 8:68349147-68349169 TCTTCAATACCTGATTTACTGGG + Intronic
1042671595 8:71269764-71269786 TTTTCCACTCCTTGCTTACTGGG - Exonic
1043561663 8:81500627-81500649 TTTTCCATTGCTCACTTGCTAGG + Intergenic
1044311956 8:90703967-90703989 TTTTCTGTTCCTGTGTTAGTTGG + Intronic
1045550747 8:103169942-103169964 GCTTCCATTCCTGAGTTCCTTGG + Intronic
1046335917 8:112786989-112787011 TTTTCTGTTCCTGTGTTAGTTGG + Intronic
1046854551 8:119016284-119016306 TTTTCTGTTCCTGTGTTAGTTGG + Intronic
1047018773 8:120752539-120752561 TTTTCCATTGATGAGTTTCTAGG - Intronic
1047674353 8:127184100-127184122 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
1048640753 8:136357772-136357794 TTTTCTGTTCCTGAGTTAGTTGG + Intergenic
1050069386 9:1794353-1794375 TAATCCATTCCTCAGTTAATGGG + Intergenic
1050195114 9:3074754-3074776 TTTTCCTTTCTTGAGTTTTTTGG + Intergenic
1050333754 9:4571116-4571138 TTTTCTGTTCCTGTGTTAGTTGG - Intronic
1050617631 9:7419146-7419168 TTTTCTCTTCCTGAGTTAGTTGG - Intergenic
1050756274 9:9008019-9008041 TTTTAAATTTCTGAGTTAATGGG - Intronic
1051133818 9:13894973-13894995 TTTTCTGTTCCTGTGTTACCTGG - Intergenic
1051347626 9:16166580-16166602 TTTTCCATTGTTGAGTTTTTTGG - Intergenic
1051688587 9:19684529-19684551 TTTCCCCTTCCTTAGTTATTTGG - Intronic
1051758249 9:20429896-20429918 TTTTGCAGTCCTGAGTTAGTAGG - Intronic
1051831477 9:21283629-21283651 TTTTCCAACTCTGAGATACTTGG + Intergenic
1051831719 9:21286503-21286525 TTTTCTGTTCCTGAATTAGTTGG + Intergenic
1051875896 9:21793369-21793391 TTTTCCATTCCCTACATACTAGG + Intergenic
1051939646 9:22490378-22490400 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
1054453310 9:65415182-65415204 TTTTCCATTGCTGAGTCAACTGG + Intergenic
1055246421 9:74249532-74249554 TTATCCATTCATCAGTTAATGGG + Intergenic
1055637820 9:78295736-78295758 TCTTGCATGCCTGAGTTTCTGGG + Intergenic
1056501743 9:87216290-87216312 CTCTCCATTCCTGAATAACTTGG + Intergenic
1058056882 9:100457684-100457706 TTCTCAATGCCTGAGTGACTGGG - Intronic
1058178221 9:101763785-101763807 TCATCCATTCCTGAGTTGCATGG + Intergenic
1059579977 9:115534802-115534824 TTTTCTGTTTCTGTGTTACTTGG - Intergenic
1062510860 9:136905111-136905133 TTAACCTTTCCTGAGTCACTTGG + Intronic
1203611345 Un_KI270749v1:8626-8648 TTCTCCATTCCTGAGCAAGTTGG + Intergenic
1185659507 X:1715607-1715629 TTTTCTGTTCCTGAGTTAGTTGG - Intergenic
1185724607 X:2409531-2409553 TTTTCTGTTCCTGCGTTAGTTGG + Intronic
1185727458 X:2433660-2433682 TTTTCTGTTCCTGCGTTATTAGG + Intronic
1185853258 X:3508728-3508750 TTTTCCATTCCTGTGTTAGTTGG + Intergenic
1188102550 X:26107921-26107943 ATTTCCATTCTGGACTTACTGGG + Intergenic
1188437684 X:30180580-30180602 TTTCCCACTACTAAGTTACTAGG - Intergenic
1190783251 X:53619516-53619538 TTTTCCATTTCTTAGTTGCTTGG - Intronic
1190905276 X:54721260-54721282 TTTTCCAGTCTTGAGATGCTGGG - Intergenic
1191172637 X:57464141-57464163 TTTTCTGTTCCTGTGTTAGTTGG - Intronic
1191811785 X:65196928-65196950 TTTGCCATTCTTGCATTACTGGG - Intergenic
1193596960 X:83458678-83458700 CTTTCTATTCCTGAGTTACTTGG - Intergenic
1193625521 X:83815550-83815572 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic
1194934269 X:99928717-99928739 TTTTCTGTTCCTGTGTTAGTCGG - Intergenic
1195811823 X:108842098-108842120 TTTTCTGTTCCTGCGTTAGTTGG + Intergenic
1196101895 X:111855380-111855402 TTTTCCTTTTCTGACTGACTGGG + Intronic
1197027255 X:121768462-121768484 TTTTCTGTTCCTGTGTTAGTTGG - Intergenic
1197166569 X:123383965-123383987 TTTTCTGTTCCTGTGTTAGTTGG + Intronic
1197593869 X:128443485-128443507 TTTTTGATTCCTCAGTTTCTGGG + Intergenic
1197643236 X:128989702-128989724 TTTTTCATTTCTGATTTATTTGG + Intergenic
1197791866 X:130263309-130263331 TTGTCCATTCCTGAGTTGATGGG - Intronic
1198297206 X:135299020-135299042 TTATCCATTCATCAGTTAATTGG + Intronic
1198309343 X:135414876-135414898 TTTTCTGTTCTTGTGTTACTTGG - Intergenic
1201521620 Y:14881628-14881650 TTTTCTGTTCCTGTGTTAGTTGG + Intergenic