ID: 1024829372

View in Genome Browser
Species Human (GRCh38)
Location 7:53431040-53431062
Sequence TGTTCTCACATAAAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024829365_1024829372 24 Left 1024829365 7:53430993-53431015 CCATATTCAAAGCCAAGTAACTC No data
Right 1024829372 7:53431040-53431062 TGTTCTCACATAAAAGTGGGAGG No data
1024829368_1024829372 12 Left 1024829368 7:53431005-53431027 CCAAGTAACTCAGGAATGGAAAA 0: 4
1: 3
2: 7
3: 34
4: 375
Right 1024829372 7:53431040-53431062 TGTTCTCACATAAAAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024829372 Original CRISPR TGTTCTCACATAAAAGTGGG AGG Intergenic
No off target data available for this crispr