ID: 1024842183

View in Genome Browser
Species Human (GRCh38)
Location 7:53600097-53600119
Sequence GTGTGCTGCCCCCTGCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024842183_1024842192 11 Left 1024842183 7:53600097-53600119 CCACAGAGCAGGGGGCAGCACAC No data
Right 1024842192 7:53600131-53600153 GAGGAAAGCGGGAGCTGTCTGGG No data
1024842183_1024842185 -8 Left 1024842183 7:53600097-53600119 CCACAGAGCAGGGGGCAGCACAC No data
Right 1024842185 7:53600112-53600134 CAGCACACCTGGAAGCCCAGAGG No data
1024842183_1024842188 0 Left 1024842183 7:53600097-53600119 CCACAGAGCAGGGGGCAGCACAC No data
Right 1024842188 7:53600120-53600142 CTGGAAGCCCAGAGGAAAGCGGG No data
1024842183_1024842191 10 Left 1024842183 7:53600097-53600119 CCACAGAGCAGGGGGCAGCACAC No data
Right 1024842191 7:53600130-53600152 AGAGGAAAGCGGGAGCTGTCTGG No data
1024842183_1024842187 -1 Left 1024842183 7:53600097-53600119 CCACAGAGCAGGGGGCAGCACAC No data
Right 1024842187 7:53600119-53600141 CCTGGAAGCCCAGAGGAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024842183 Original CRISPR GTGTGCTGCCCCCTGCTCTG TGG (reversed) Intergenic
No off target data available for this crispr