ID: 1024842188

View in Genome Browser
Species Human (GRCh38)
Location 7:53600120-53600142
Sequence CTGGAAGCCCAGAGGAAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024842183_1024842188 0 Left 1024842183 7:53600097-53600119 CCACAGAGCAGGGGGCAGCACAC No data
Right 1024842188 7:53600120-53600142 CTGGAAGCCCAGAGGAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024842188 Original CRISPR CTGGAAGCCCAGAGGAAAGC GGG Intergenic
No off target data available for this crispr