ID: 1024853144

View in Genome Browser
Species Human (GRCh38)
Location 7:53744543-53744565
Sequence GGGCTAGCAGCAGTGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024853144_1024853151 -2 Left 1024853144 7:53744543-53744565 CCCACCACCACTGCTGCTAGCCC No data
Right 1024853151 7:53744564-53744586 CCAGTTGGATTTGCAAGTTTAGG No data
1024853144_1024853153 16 Left 1024853144 7:53744543-53744565 CCCACCACCACTGCTGCTAGCCC No data
Right 1024853153 7:53744582-53744604 TTAGGCATTGCCTAAGCAGGTGG No data
1024853144_1024853152 13 Left 1024853144 7:53744543-53744565 CCCACCACCACTGCTGCTAGCCC No data
Right 1024853152 7:53744579-53744601 AGTTTAGGCATTGCCTAAGCAGG No data
1024853144_1024853154 17 Left 1024853144 7:53744543-53744565 CCCACCACCACTGCTGCTAGCCC No data
Right 1024853154 7:53744583-53744605 TAGGCATTGCCTAAGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024853144 Original CRISPR GGGCTAGCAGCAGTGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr