ID: 1024854848

View in Genome Browser
Species Human (GRCh38)
Location 7:53766109-53766131
Sequence GAGTCTCCCCGAGCCCTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024854848_1024854849 30 Left 1024854848 7:53766109-53766131 CCAATAAGGGCTCGGGGAGACTC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1024854849 7:53766162-53766184 ATACATCTATATTCTTGTCTTGG 0: 1
1: 0
2: 1
3: 22
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024854848 Original CRISPR GAGTCTCCCCGAGCCCTTAT TGG (reversed) Intergenic
902815702 1:18915360-18915382 GAGCCTCCCAGAGCTCTGATTGG + Intronic
924590758 1:245402046-245402068 GAGGCTCCCCTAGGCCTCATGGG + Intronic
1092171586 12:6376693-6376715 GAGTCTCCTCCAGCCCTTTTTGG - Intronic
1103925254 12:124420390-124420412 ATGTCACCCCCAGCCCTTATGGG + Intronic
1107707198 13:43119793-43119815 GAGTTTCCCCGAATCATTATTGG + Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1129456353 15:75677832-75677854 GATGCCCCCCGAGCCCTTTTGGG - Exonic
1133110248 16:3543728-3543750 CATTCTCCCCGAGCCCTTCCAGG - Intronic
1145933506 17:28702004-28702026 GAGTCTCCCCTAGCTCTCGTGGG + Exonic
1147234154 17:39044851-39044873 AAGTCTCCCCGAGACATTGTGGG + Intergenic
1161769064 19:6221694-6221716 GAGTCTCCCAGATGCCCTATTGG + Intronic
1165601090 19:37056392-37056414 GTGTGTCACCGAGCCCATATGGG - Intronic
925003463 2:424519-424541 CAGTCTCCCCGACCCCTGACTGG - Intergenic
925475088 2:4204400-4204422 GAGTCTTCCCAAGCCCTCCTGGG - Intergenic
929631307 2:43465674-43465696 GAGTCTACCCTAGCCCCTCTGGG + Intronic
936243072 2:110805102-110805124 GGGACTCCCCCTGCCCTTATCGG + Intronic
943474938 2:188342279-188342301 GAGTCTCTCCTAGCCCTTGGTGG + Intronic
954686855 3:52375817-52375839 GAGTGTCTCTGAGCCTTTATGGG + Intronic
969574703 4:8030143-8030165 GAGACTCCCCCAGTCCCTATGGG + Intronic
982304105 4:153911549-153911571 AAGGCTCCCCCATCCCTTATTGG - Intergenic
983457294 4:167981221-167981243 CAGTCTCCATGTGCCCTTATAGG + Intergenic
985977067 5:3428493-3428515 GGGTCTGGCCGAGCCCTCATGGG - Intergenic
987886781 5:23823564-23823586 GAGTCTCCCTGAGCTCTTTTCGG - Intergenic
1002072507 5:176688505-176688527 GAGTCTCCCTGTGCTCTTGTGGG - Intergenic
1004304383 6:14487244-14487266 GAGCCTCCCCGTGCCCTTGGGGG + Intergenic
1004440152 6:15642204-15642226 GACTCTCCCTGAGCCCATTTTGG + Intronic
1006097446 6:31664933-31664955 GACTCTCCCCGAGATCTTCTAGG - Exonic
1006477957 6:34269797-34269819 CAGGCTGCCCGAGCCCTTGTTGG + Intergenic
1024854848 7:53766109-53766131 GAGTCTCCCCGAGCCCTTATTGG - Intergenic
1030109011 7:106010517-106010539 GAGTCTCCACGATGCCTCATTGG - Intronic
1031586975 7:123543254-123543276 CAATCTCCCCCAGCCATTATAGG + Intronic
1044882374 8:96736838-96736860 GAATCTCTCTGAGCCCATATTGG + Intronic
1061401483 9:130370720-130370742 CAGTCTCCCCAAGCCCTCAGCGG - Intronic
1061513080 9:131072623-131072645 AAGGCTTCCCGAGCCCCTATGGG - Exonic
1062360055 9:136183354-136183376 GATTCTCCCCCAGCCCTTGGAGG - Intergenic