ID: 1024858203

View in Genome Browser
Species Human (GRCh38)
Location 7:53806258-53806280
Sequence CCCTGGACACTAATGCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024858203_1024858208 25 Left 1024858203 7:53806258-53806280 CCACTGAGCATTAGTGTCCAGGG No data
Right 1024858208 7:53806306-53806328 GCATGGTCAATGTAATCCATTGG No data
1024858203_1024858206 3 Left 1024858203 7:53806258-53806280 CCACTGAGCATTAGTGTCCAGGG No data
Right 1024858206 7:53806284-53806306 TTGTTGAAATGTAATTACATAGG No data
1024858203_1024858207 8 Left 1024858203 7:53806258-53806280 CCACTGAGCATTAGTGTCCAGGG No data
Right 1024858207 7:53806289-53806311 GAAATGTAATTACATAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024858203 Original CRISPR CCCTGGACACTAATGCTCAG TGG (reversed) Intergenic
No off target data available for this crispr