ID: 1024858975

View in Genome Browser
Species Human (GRCh38)
Location 7:53815548-53815570
Sequence CTATGGGAAAGAAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024858975_1024858981 -1 Left 1024858975 7:53815548-53815570 CCATCTTCCCTTCTTTCCCATAG No data
Right 1024858981 7:53815570-53815592 GAAAACACAATACAGCCTCTGGG No data
1024858975_1024858982 0 Left 1024858975 7:53815548-53815570 CCATCTTCCCTTCTTTCCCATAG No data
Right 1024858982 7:53815571-53815593 AAAACACAATACAGCCTCTGGGG No data
1024858975_1024858983 4 Left 1024858975 7:53815548-53815570 CCATCTTCCCTTCTTTCCCATAG No data
Right 1024858983 7:53815575-53815597 CACAATACAGCCTCTGGGGCAGG No data
1024858975_1024858980 -2 Left 1024858975 7:53815548-53815570 CCATCTTCCCTTCTTTCCCATAG No data
Right 1024858980 7:53815569-53815591 AGAAAACACAATACAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024858975 Original CRISPR CTATGGGAAAGAAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr