ID: 1024862555

View in Genome Browser
Species Human (GRCh38)
Location 7:53862397-53862419
Sequence GAAACCACTCTATCAGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 2, 2: 0, 3: 11, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024862553_1024862555 25 Left 1024862553 7:53862349-53862371 CCTGTGTTGCACAATCAAAGAGA No data
Right 1024862555 7:53862397-53862419 GAAACCACTCTATCAGATTTTGG 0: 1
1: 2
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024862555 Original CRISPR GAAACCACTCTATCAGATTT TGG Intergenic