ID: 1024865946

View in Genome Browser
Species Human (GRCh38)
Location 7:53905156-53905178
Sequence AGGATGAGTCCAGGACCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024865946_1024865953 12 Left 1024865946 7:53905156-53905178 CCAGTGGGTCCTGGACTCATCCT No data
Right 1024865953 7:53905191-53905213 CCAGTGCCAGAATGCATAATTGG 0: 156
1: 150
2: 118
3: 95
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024865946 Original CRISPR AGGATGAGTCCAGGACCCAC TGG (reversed) Intergenic
No off target data available for this crispr