ID: 1024866099

View in Genome Browser
Species Human (GRCh38)
Location 7:53906315-53906337
Sequence AGTTATCTGAAAAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024866099_1024866106 22 Left 1024866099 7:53906315-53906337 CCTGCCACCTTTTTCAGATAACT No data
Right 1024866106 7:53906360-53906382 CTTGGCTTGTTACTGGGCTTTGG No data
1024866099_1024866104 15 Left 1024866099 7:53906315-53906337 CCTGCCACCTTTTTCAGATAACT No data
Right 1024866104 7:53906353-53906375 GACAGTTCTTGGCTTGTTACTGG No data
1024866099_1024866102 4 Left 1024866099 7:53906315-53906337 CCTGCCACCTTTTTCAGATAACT No data
Right 1024866102 7:53906342-53906364 TCCTTTTGAGAGACAGTTCTTGG No data
1024866099_1024866105 16 Left 1024866099 7:53906315-53906337 CCTGCCACCTTTTTCAGATAACT No data
Right 1024866105 7:53906354-53906376 ACAGTTCTTGGCTTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024866099 Original CRISPR AGTTATCTGAAAAAGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr