ID: 1024866202

View in Genome Browser
Species Human (GRCh38)
Location 7:53907138-53907160
Sequence TTGGGCAATGACGGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024866202_1024866209 -3 Left 1024866202 7:53907138-53907160 CCAGCCACCCCGTCATTGCCCAA No data
Right 1024866209 7:53907158-53907180 CAATGTGCCCATGAAAAAAGTGG No data
1024866202_1024866213 5 Left 1024866202 7:53907138-53907160 CCAGCCACCCCGTCATTGCCCAA No data
Right 1024866213 7:53907166-53907188 CCATGAAAAAAGTGGCATGGTGG No data
1024866202_1024866210 2 Left 1024866202 7:53907138-53907160 CCAGCCACCCCGTCATTGCCCAA No data
Right 1024866210 7:53907163-53907185 TGCCCATGAAAAAAGTGGCATGG No data
1024866202_1024866214 14 Left 1024866202 7:53907138-53907160 CCAGCCACCCCGTCATTGCCCAA No data
Right 1024866214 7:53907175-53907197 AAGTGGCATGGTGGCAGAGATGG No data
1024866202_1024866215 27 Left 1024866202 7:53907138-53907160 CCAGCCACCCCGTCATTGCCCAA No data
Right 1024866215 7:53907188-53907210 GCAGAGATGGATGTTATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024866202 Original CRISPR TTGGGCAATGACGGGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr