ID: 1024866764

View in Genome Browser
Species Human (GRCh38)
Location 7:53912095-53912117
Sequence ACACACATGGAGAAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024866764_1024866772 18 Left 1024866764 7:53912095-53912117 CCCACCACCTTCTCCATGTGTGT No data
Right 1024866772 7:53912136-53912158 TTTACCTCCTTCTTAGAAGGAGG No data
1024866764_1024866770 15 Left 1024866764 7:53912095-53912117 CCCACCACCTTCTCCATGTGTGT No data
Right 1024866770 7:53912133-53912155 CCCTTTACCTCCTTCTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024866764 Original CRISPR ACACACATGGAGAAGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr