ID: 1024866770

View in Genome Browser
Species Human (GRCh38)
Location 7:53912133-53912155
Sequence CCCTTTACCTCCTTCTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024866763_1024866770 30 Left 1024866763 7:53912080-53912102 CCTCTGTTGCATCTTCCCACCAC No data
Right 1024866770 7:53912133-53912155 CCCTTTACCTCCTTCTTAGAAGG No data
1024866764_1024866770 15 Left 1024866764 7:53912095-53912117 CCCACCACCTTCTCCATGTGTGT No data
Right 1024866770 7:53912133-53912155 CCCTTTACCTCCTTCTTAGAAGG No data
1024866765_1024866770 14 Left 1024866765 7:53912096-53912118 CCACCACCTTCTCCATGTGTGTC No data
Right 1024866770 7:53912133-53912155 CCCTTTACCTCCTTCTTAGAAGG No data
1024866768_1024866770 2 Left 1024866768 7:53912108-53912130 CCATGTGTGTCTGTGTATGAAAT No data
Right 1024866770 7:53912133-53912155 CCCTTTACCTCCTTCTTAGAAGG No data
1024866767_1024866770 8 Left 1024866767 7:53912102-53912124 CCTTCTCCATGTGTGTCTGTGTA No data
Right 1024866770 7:53912133-53912155 CCCTTTACCTCCTTCTTAGAAGG No data
1024866766_1024866770 11 Left 1024866766 7:53912099-53912121 CCACCTTCTCCATGTGTGTCTGT No data
Right 1024866770 7:53912133-53912155 CCCTTTACCTCCTTCTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024866770 Original CRISPR CCCTTTACCTCCTTCTTAGA AGG Intergenic
No off target data available for this crispr