ID: 1024866772

View in Genome Browser
Species Human (GRCh38)
Location 7:53912136-53912158
Sequence TTTACCTCCTTCTTAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024866767_1024866772 11 Left 1024866767 7:53912102-53912124 CCTTCTCCATGTGTGTCTGTGTA No data
Right 1024866772 7:53912136-53912158 TTTACCTCCTTCTTAGAAGGAGG No data
1024866766_1024866772 14 Left 1024866766 7:53912099-53912121 CCACCTTCTCCATGTGTGTCTGT No data
Right 1024866772 7:53912136-53912158 TTTACCTCCTTCTTAGAAGGAGG No data
1024866765_1024866772 17 Left 1024866765 7:53912096-53912118 CCACCACCTTCTCCATGTGTGTC No data
Right 1024866772 7:53912136-53912158 TTTACCTCCTTCTTAGAAGGAGG No data
1024866768_1024866772 5 Left 1024866768 7:53912108-53912130 CCATGTGTGTCTGTGTATGAAAT No data
Right 1024866772 7:53912136-53912158 TTTACCTCCTTCTTAGAAGGAGG No data
1024866764_1024866772 18 Left 1024866764 7:53912095-53912117 CCCACCACCTTCTCCATGTGTGT No data
Right 1024866772 7:53912136-53912158 TTTACCTCCTTCTTAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024866772 Original CRISPR TTTACCTCCTTCTTAGAAGG AGG Intergenic
No off target data available for this crispr