ID: 1024867290

View in Genome Browser
Species Human (GRCh38)
Location 7:53918723-53918745
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024867290_1024867293 1 Left 1024867290 7:53918723-53918745 CCATTTGTTATTAAGAGCAAGAG No data
Right 1024867293 7:53918747-53918769 CATGGCTAAAGCATCTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024867290 Original CRISPR CTCTTGCTCTTAATAACAAA TGG (reversed) Intergenic
No off target data available for this crispr