ID: 1024880585

View in Genome Browser
Species Human (GRCh38)
Location 7:54081216-54081238
Sequence GCCACGCATGTAATTGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024880583_1024880585 10 Left 1024880583 7:54081183-54081205 CCAGGAGAGGCATTCTTTCTGCA No data
Right 1024880585 7:54081216-54081238 GCCACGCATGTAATTGAGACTGG No data
1024880581_1024880585 18 Left 1024880581 7:54081175-54081197 CCTGAGACCCAGGAGAGGCATTC No data
Right 1024880585 7:54081216-54081238 GCCACGCATGTAATTGAGACTGG No data
1024880582_1024880585 11 Left 1024880582 7:54081182-54081204 CCCAGGAGAGGCATTCTTTCTGC No data
Right 1024880585 7:54081216-54081238 GCCACGCATGTAATTGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024880585 Original CRISPR GCCACGCATGTAATTGAGAC TGG Intergenic