ID: 1024884341

View in Genome Browser
Species Human (GRCh38)
Location 7:54124644-54124666
Sequence ACAGTTCTTTGCCTATTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024884341_1024884345 16 Left 1024884341 7:54124644-54124666 CCCAGTAATAGGCAAAGAACTGT No data
Right 1024884345 7:54124683-54124705 AGCTATCTAAAGAAGATGGCAGG No data
1024884341_1024884344 12 Left 1024884341 7:54124644-54124666 CCCAGTAATAGGCAAAGAACTGT No data
Right 1024884344 7:54124679-54124701 GAGTAGCTATCTAAAGAAGATGG No data
1024884341_1024884346 17 Left 1024884341 7:54124644-54124666 CCCAGTAATAGGCAAAGAACTGT No data
Right 1024884346 7:54124684-54124706 GCTATCTAAAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024884341 Original CRISPR ACAGTTCTTTGCCTATTACT GGG (reversed) Intergenic
No off target data available for this crispr