ID: 1024884345

View in Genome Browser
Species Human (GRCh38)
Location 7:54124683-54124705
Sequence AGCTATCTAAAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024884340_1024884345 22 Left 1024884340 7:54124638-54124660 CCAAAGCCCAGTAATAGGCAAAG No data
Right 1024884345 7:54124683-54124705 AGCTATCTAAAGAAGATGGCAGG No data
1024884341_1024884345 16 Left 1024884341 7:54124644-54124666 CCCAGTAATAGGCAAAGAACTGT No data
Right 1024884345 7:54124683-54124705 AGCTATCTAAAGAAGATGGCAGG No data
1024884339_1024884345 25 Left 1024884339 7:54124635-54124657 CCACCAAAGCCCAGTAATAGGCA No data
Right 1024884345 7:54124683-54124705 AGCTATCTAAAGAAGATGGCAGG No data
1024884342_1024884345 15 Left 1024884342 7:54124645-54124667 CCAGTAATAGGCAAAGAACTGTC No data
Right 1024884345 7:54124683-54124705 AGCTATCTAAAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024884345 Original CRISPR AGCTATCTAAAGAAGATGGC AGG Intergenic
No off target data available for this crispr