ID: 1024887621

View in Genome Browser
Species Human (GRCh38)
Location 7:54162237-54162259
Sequence GTTTCCTTGGATTTAAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024887619_1024887621 -2 Left 1024887619 7:54162216-54162238 CCTTACAATTTCATGATTCTGGT No data
Right 1024887621 7:54162237-54162259 GTTTCCTTGGATTTAAAACTAGG No data
1024887617_1024887621 -1 Left 1024887617 7:54162215-54162237 CCCTTACAATTTCATGATTCTGG No data
Right 1024887621 7:54162237-54162259 GTTTCCTTGGATTTAAAACTAGG No data
1024887616_1024887621 11 Left 1024887616 7:54162203-54162225 CCTCAGAAATGGCCCTTACAATT No data
Right 1024887621 7:54162237-54162259 GTTTCCTTGGATTTAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024887621 Original CRISPR GTTTCCTTGGATTTAAAACT AGG Intergenic
No off target data available for this crispr