ID: 1024889687

View in Genome Browser
Species Human (GRCh38)
Location 7:54185730-54185752
Sequence TGAGCTGTGATTAGGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024889680_1024889687 9 Left 1024889680 7:54185698-54185720 CCAATGTGACAATGTTAAGAGGT No data
Right 1024889687 7:54185730-54185752 TGAGCTGTGATTAGGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024889687 Original CRISPR TGAGCTGTGATTAGGCCAGG AGG Intergenic
No off target data available for this crispr