ID: 1024890656

View in Genome Browser
Species Human (GRCh38)
Location 7:54197937-54197959
Sequence ATGTTCTAACAGGGGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024890649_1024890656 10 Left 1024890649 7:54197904-54197926 CCACACTTGGGGAGAAAAGAACT No data
Right 1024890656 7:54197937-54197959 ATGTTCTAACAGGGGGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024890656 Original CRISPR ATGTTCTAACAGGGGGAGTA GGG Intergenic
No off target data available for this crispr