ID: 1024890816

View in Genome Browser
Species Human (GRCh38)
Location 7:54200735-54200757
Sequence CTGACTCAACACATCTGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024890816_1024890818 -5 Left 1024890816 7:54200735-54200757 CCAATACAGATGTGTTGAGTCAG No data
Right 1024890818 7:54200753-54200775 GTCAGTGGCACAAATACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024890816 Original CRISPR CTGACTCAACACATCTGTAT TGG (reversed) Intergenic
No off target data available for this crispr