ID: 1024894557

View in Genome Browser
Species Human (GRCh38)
Location 7:54242987-54243009
Sequence GGAAATAACCTGATGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024894551_1024894557 15 Left 1024894551 7:54242949-54242971 CCACAGTGAATCACTACAGAAAT No data
Right 1024894557 7:54242987-54243009 GGAAATAACCTGATGAAGCTTGG No data
1024894555_1024894557 -9 Left 1024894555 7:54242973-54242995 CCCTGCGTTTGGCGGGAAATAAC No data
Right 1024894557 7:54242987-54243009 GGAAATAACCTGATGAAGCTTGG No data
1024894550_1024894557 19 Left 1024894550 7:54242945-54242967 CCAACCACAGTGAATCACTACAG No data
Right 1024894557 7:54242987-54243009 GGAAATAACCTGATGAAGCTTGG No data
1024894556_1024894557 -10 Left 1024894556 7:54242974-54242996 CCTGCGTTTGGCGGGAAATAACC No data
Right 1024894557 7:54242987-54243009 GGAAATAACCTGATGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024894557 Original CRISPR GGAAATAACCTGATGAAGCT TGG Intergenic
No off target data available for this crispr