ID: 1024895418

View in Genome Browser
Species Human (GRCh38)
Location 7:54255455-54255477
Sequence ATGAATATAAATATCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024895418_1024895421 16 Left 1024895418 7:54255455-54255477 CCATCCTGGATATTTATATTCAT No data
Right 1024895421 7:54255494-54255516 ACTATCTGACCTTTTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024895418 Original CRISPR ATGAATATAAATATCCAGGA TGG (reversed) Intergenic
No off target data available for this crispr