ID: 1024896232

View in Genome Browser
Species Human (GRCh38)
Location 7:54265447-54265469
Sequence ACCCTCAGCTTCCAGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024896232_1024896240 13 Left 1024896232 7:54265447-54265469 CCCAGTCCCTGGAAGCTGAGGGT No data
Right 1024896240 7:54265483-54265505 GGGAAGAGAGATTAGTGTAGAGG No data
1024896232_1024896237 -9 Left 1024896232 7:54265447-54265469 CCCAGTCCCTGGAAGCTGAGGGT No data
Right 1024896237 7:54265461-54265483 GCTGAGGGTTAAGAAGGAAAAGG No data
1024896232_1024896239 -7 Left 1024896232 7:54265447-54265469 CCCAGTCCCTGGAAGCTGAGGGT No data
Right 1024896239 7:54265463-54265485 TGAGGGTTAAGAAGGAAAAGGGG No data
1024896232_1024896238 -8 Left 1024896232 7:54265447-54265469 CCCAGTCCCTGGAAGCTGAGGGT No data
Right 1024896238 7:54265462-54265484 CTGAGGGTTAAGAAGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024896232 Original CRISPR ACCCTCAGCTTCCAGGGACT GGG (reversed) Intergenic
No off target data available for this crispr