ID: 1024896235

View in Genome Browser
Species Human (GRCh38)
Location 7:54265454-54265476
Sequence CTTCTTAACCCTCAGCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024896235_1024896241 29 Left 1024896235 7:54265454-54265476 CCTGGAAGCTGAGGGTTAAGAAG No data
Right 1024896241 7:54265506-54265528 ATGAAAAGATAAGAATGACAAGG No data
1024896235_1024896240 6 Left 1024896235 7:54265454-54265476 CCTGGAAGCTGAGGGTTAAGAAG No data
Right 1024896240 7:54265483-54265505 GGGAAGAGAGATTAGTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024896235 Original CRISPR CTTCTTAACCCTCAGCTTCC AGG (reversed) Intergenic
No off target data available for this crispr