ID: 1024896236

View in Genome Browser
Species Human (GRCh38)
Location 7:54265455-54265477
Sequence CTGGAAGCTGAGGGTTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024896229_1024896236 -8 Left 1024896229 7:54265440-54265462 CCAGGAACCCAGTCCCTGGAAGC No data
Right 1024896236 7:54265455-54265477 CTGGAAGCTGAGGGTTAAGAAGG No data
1024896227_1024896236 5 Left 1024896227 7:54265427-54265449 CCTGGGAATCGAACCAGGAACCC No data
Right 1024896236 7:54265455-54265477 CTGGAAGCTGAGGGTTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024896236 Original CRISPR CTGGAAGCTGAGGGTTAAGA AGG Intergenic
No off target data available for this crispr