ID: 1024896239

View in Genome Browser
Species Human (GRCh38)
Location 7:54265463-54265485
Sequence TGAGGGTTAAGAAGGAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024896229_1024896239 0 Left 1024896229 7:54265440-54265462 CCAGGAACCCAGTCCCTGGAAGC No data
Right 1024896239 7:54265463-54265485 TGAGGGTTAAGAAGGAAAAGGGG No data
1024896232_1024896239 -7 Left 1024896232 7:54265447-54265469 CCCAGTCCCTGGAAGCTGAGGGT No data
Right 1024896239 7:54265463-54265485 TGAGGGTTAAGAAGGAAAAGGGG No data
1024896233_1024896239 -8 Left 1024896233 7:54265448-54265470 CCAGTCCCTGGAAGCTGAGGGTT No data
Right 1024896239 7:54265463-54265485 TGAGGGTTAAGAAGGAAAAGGGG No data
1024896227_1024896239 13 Left 1024896227 7:54265427-54265449 CCTGGGAATCGAACCAGGAACCC No data
Right 1024896239 7:54265463-54265485 TGAGGGTTAAGAAGGAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024896239 Original CRISPR TGAGGGTTAAGAAGGAAAAG GGG Intergenic
No off target data available for this crispr