ID: 1024896240

View in Genome Browser
Species Human (GRCh38)
Location 7:54265483-54265505
Sequence GGGAAGAGAGATTAGTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024896235_1024896240 6 Left 1024896235 7:54265454-54265476 CCTGGAAGCTGAGGGTTAAGAAG No data
Right 1024896240 7:54265483-54265505 GGGAAGAGAGATTAGTGTAGAGG No data
1024896232_1024896240 13 Left 1024896232 7:54265447-54265469 CCCAGTCCCTGGAAGCTGAGGGT No data
Right 1024896240 7:54265483-54265505 GGGAAGAGAGATTAGTGTAGAGG No data
1024896234_1024896240 7 Left 1024896234 7:54265453-54265475 CCCTGGAAGCTGAGGGTTAAGAA No data
Right 1024896240 7:54265483-54265505 GGGAAGAGAGATTAGTGTAGAGG No data
1024896233_1024896240 12 Left 1024896233 7:54265448-54265470 CCAGTCCCTGGAAGCTGAGGGTT No data
Right 1024896240 7:54265483-54265505 GGGAAGAGAGATTAGTGTAGAGG No data
1024896229_1024896240 20 Left 1024896229 7:54265440-54265462 CCAGGAACCCAGTCCCTGGAAGC No data
Right 1024896240 7:54265483-54265505 GGGAAGAGAGATTAGTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024896240 Original CRISPR GGGAAGAGAGATTAGTGTAG AGG Intergenic
No off target data available for this crispr