ID: 1024896672

View in Genome Browser
Species Human (GRCh38)
Location 7:54268824-54268846
Sequence CCTACTAAGAAAAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024896672_1024896678 -6 Left 1024896672 7:54268824-54268846 CCTTCTTCCTTTTTCTTAGTAGG No data
Right 1024896678 7:54268841-54268863 AGTAGGAAAGTCAAAAAAGGGGG No data
1024896672_1024896676 -8 Left 1024896672 7:54268824-54268846 CCTTCTTCCTTTTTCTTAGTAGG No data
Right 1024896676 7:54268839-54268861 TTAGTAGGAAAGTCAAAAAAGGG No data
1024896672_1024896675 -9 Left 1024896672 7:54268824-54268846 CCTTCTTCCTTTTTCTTAGTAGG No data
Right 1024896675 7:54268838-54268860 CTTAGTAGGAAAGTCAAAAAAGG No data
1024896672_1024896677 -7 Left 1024896672 7:54268824-54268846 CCTTCTTCCTTTTTCTTAGTAGG No data
Right 1024896677 7:54268840-54268862 TAGTAGGAAAGTCAAAAAAGGGG No data
1024896672_1024896679 13 Left 1024896672 7:54268824-54268846 CCTTCTTCCTTTTTCTTAGTAGG No data
Right 1024896679 7:54268860-54268882 GGGGTTTCCAAAACATGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024896672 Original CRISPR CCTACTAAGAAAAAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr