ID: 1024901811

View in Genome Browser
Species Human (GRCh38)
Location 7:54326721-54326743
Sequence AGAGCTTTTTGCCAAAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024901811_1024901812 15 Left 1024901811 7:54326721-54326743 CCTCTATTTTGGCAAAAAGCTCT No data
Right 1024901812 7:54326759-54326781 CTAATTCACAAGCTCTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024901811 Original CRISPR AGAGCTTTTTGCCAAAATAG AGG (reversed) Intergenic
No off target data available for this crispr