ID: 1024903951

View in Genome Browser
Species Human (GRCh38)
Location 7:54354593-54354615
Sequence TAGCCGTGTGACTGGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024903943_1024903951 24 Left 1024903943 7:54354546-54354568 CCTGGAAGTAATAGCTCCATAAA No data
Right 1024903951 7:54354593-54354615 TAGCCGTGTGACTGGCTGGCTGG No data
1024903945_1024903951 -1 Left 1024903945 7:54354571-54354593 CCGTTCATTTCCGCTTTTTCCCT No data
Right 1024903951 7:54354593-54354615 TAGCCGTGTGACTGGCTGGCTGG No data
1024903944_1024903951 8 Left 1024903944 7:54354562-54354584 CCATAAAAGCCGTTCATTTCCGC No data
Right 1024903951 7:54354593-54354615 TAGCCGTGTGACTGGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024903951 Original CRISPR TAGCCGTGTGACTGGCTGGC TGG Intergenic
No off target data available for this crispr