ID: 1024905545

View in Genome Browser
Species Human (GRCh38)
Location 7:54374869-54374891
Sequence GGCAAAAGGGCAGCGTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024905545_1024905552 29 Left 1024905545 7:54374869-54374891 CCTACATACGCTGCCCTTTTGCC No data
Right 1024905552 7:54374921-54374943 CTAAAGCTAATCCCTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024905545 Original CRISPR GGCAAAAGGGCAGCGTATGT AGG (reversed) Intergenic
No off target data available for this crispr