ID: 1024905547

View in Genome Browser
Species Human (GRCh38)
Location 7:54374883-54374905
Sequence GTTCTGCAGTAACAGGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024905547_1024905552 15 Left 1024905547 7:54374883-54374905 CCTTTTGCCTGTTACTGCAGAAC No data
Right 1024905552 7:54374921-54374943 CTAAAGCTAATCCCTCCCAGTGG No data
1024905547_1024905553 23 Left 1024905547 7:54374883-54374905 CCTTTTGCCTGTTACTGCAGAAC No data
Right 1024905553 7:54374929-54374951 AATCCCTCCCAGTGGCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024905547 Original CRISPR GTTCTGCAGTAACAGGCAAA AGG (reversed) Intergenic
No off target data available for this crispr