ID: 1024905548

View in Genome Browser
Species Human (GRCh38)
Location 7:54374890-54374912
Sequence GTGGGTGGTTCTGCAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024905548_1024905553 16 Left 1024905548 7:54374890-54374912 CCTGTTACTGCAGAACCACCCAC No data
Right 1024905553 7:54374929-54374951 AATCCCTCCCAGTGGCCATGAGG No data
1024905548_1024905552 8 Left 1024905548 7:54374890-54374912 CCTGTTACTGCAGAACCACCCAC No data
Right 1024905552 7:54374921-54374943 CTAAAGCTAATCCCTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024905548 Original CRISPR GTGGGTGGTTCTGCAGTAAC AGG (reversed) Intergenic
No off target data available for this crispr