ID: 1024905548 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:54374890-54374912 |
| Sequence | GTGGGTGGTTCTGCAGTAAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 124 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 111} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1024905548_1024905553 | 16 | Left | 1024905548 | 7:54374890-54374912 | CCTGTTACTGCAGAACCACCCAC | 0: 1 1: 0 2: 0 3: 12 4: 111 |
||
| Right | 1024905553 | 7:54374929-54374951 | AATCCCTCCCAGTGGCCATGAGG | No data | ||||
| 1024905548_1024905552 | 8 | Left | 1024905548 | 7:54374890-54374912 | CCTGTTACTGCAGAACCACCCAC | 0: 1 1: 0 2: 0 3: 12 4: 111 |
||
| Right | 1024905552 | 7:54374921-54374943 | CTAAAGCTAATCCCTCCCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1024905548 | Original CRISPR | GTGGGTGGTTCTGCAGTAAC AGG (reversed) | Intergenic | ||