ID: 1024905550

View in Genome Browser
Species Human (GRCh38)
Location 7:54374908-54374930
Sequence TTAGCTTTAGACAGAAACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024905550_1024905552 -10 Left 1024905550 7:54374908-54374930 CCCACGTTTCTGTCTAAAGCTAA No data
Right 1024905552 7:54374921-54374943 CTAAAGCTAATCCCTCCCAGTGG No data
1024905550_1024905553 -2 Left 1024905550 7:54374908-54374930 CCCACGTTTCTGTCTAAAGCTAA No data
Right 1024905553 7:54374929-54374951 AATCCCTCCCAGTGGCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024905550 Original CRISPR TTAGCTTTAGACAGAAACGT GGG (reversed) Intergenic