ID: 1024905552

View in Genome Browser
Species Human (GRCh38)
Location 7:54374921-54374943
Sequence CTAAAGCTAATCCCTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024905549_1024905552 -7 Left 1024905549 7:54374905-54374927 CCACCCACGTTTCTGTCTAAAGC No data
Right 1024905552 7:54374921-54374943 CTAAAGCTAATCCCTCCCAGTGG No data
1024905548_1024905552 8 Left 1024905548 7:54374890-54374912 CCTGTTACTGCAGAACCACCCAC No data
Right 1024905552 7:54374921-54374943 CTAAAGCTAATCCCTCCCAGTGG No data
1024905547_1024905552 15 Left 1024905547 7:54374883-54374905 CCTTTTGCCTGTTACTGCAGAAC No data
Right 1024905552 7:54374921-54374943 CTAAAGCTAATCCCTCCCAGTGG No data
1024905545_1024905552 29 Left 1024905545 7:54374869-54374891 CCTACATACGCTGCCCTTTTGCC No data
Right 1024905552 7:54374921-54374943 CTAAAGCTAATCCCTCCCAGTGG No data
1024905546_1024905552 16 Left 1024905546 7:54374882-54374904 CCCTTTTGCCTGTTACTGCAGAA No data
Right 1024905552 7:54374921-54374943 CTAAAGCTAATCCCTCCCAGTGG No data
1024905550_1024905552 -10 Left 1024905550 7:54374908-54374930 CCCACGTTTCTGTCTAAAGCTAA No data
Right 1024905552 7:54374921-54374943 CTAAAGCTAATCCCTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024905552 Original CRISPR CTAAAGCTAATCCCTCCCAG TGG Intergenic
No off target data available for this crispr