ID: 1024905553

View in Genome Browser
Species Human (GRCh38)
Location 7:54374929-54374951
Sequence AATCCCTCCCAGTGGCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024905547_1024905553 23 Left 1024905547 7:54374883-54374905 CCTTTTGCCTGTTACTGCAGAAC No data
Right 1024905553 7:54374929-54374951 AATCCCTCCCAGTGGCCATGAGG No data
1024905550_1024905553 -2 Left 1024905550 7:54374908-54374930 CCCACGTTTCTGTCTAAAGCTAA No data
Right 1024905553 7:54374929-54374951 AATCCCTCCCAGTGGCCATGAGG No data
1024905551_1024905553 -3 Left 1024905551 7:54374909-54374931 CCACGTTTCTGTCTAAAGCTAAT No data
Right 1024905553 7:54374929-54374951 AATCCCTCCCAGTGGCCATGAGG No data
1024905549_1024905553 1 Left 1024905549 7:54374905-54374927 CCACCCACGTTTCTGTCTAAAGC No data
Right 1024905553 7:54374929-54374951 AATCCCTCCCAGTGGCCATGAGG No data
1024905548_1024905553 16 Left 1024905548 7:54374890-54374912 CCTGTTACTGCAGAACCACCCAC No data
Right 1024905553 7:54374929-54374951 AATCCCTCCCAGTGGCCATGAGG No data
1024905546_1024905553 24 Left 1024905546 7:54374882-54374904 CCCTTTTGCCTGTTACTGCAGAA No data
Right 1024905553 7:54374929-54374951 AATCCCTCCCAGTGGCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024905553 Original CRISPR AATCCCTCCCAGTGGCCATG AGG Intergenic
No off target data available for this crispr