ID: 1024906730

View in Genome Browser
Species Human (GRCh38)
Location 7:54391210-54391232
Sequence CTAATTCAAAACTTATTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024906730_1024906731 3 Left 1024906730 7:54391210-54391232 CCTTTAAATAAGTTTTGAATTAG No data
Right 1024906731 7:54391236-54391258 AAAGTTAGTTCCCTTTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024906730 Original CRISPR CTAATTCAAAACTTATTTAA AGG (reversed) Intergenic
No off target data available for this crispr