ID: 1024910904

View in Genome Browser
Species Human (GRCh38)
Location 7:54445652-54445674
Sequence TGTACTATGCAGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024910904_1024910911 28 Left 1024910904 7:54445652-54445674 CCTTCCTGCTTCTGCATAGTACA No data
Right 1024910911 7:54445703-54445725 TTTGAGCAGGCATCTGTGTAGGG No data
1024910904_1024910910 27 Left 1024910904 7:54445652-54445674 CCTTCCTGCTTCTGCATAGTACA No data
Right 1024910910 7:54445702-54445724 CTTTGAGCAGGCATCTGTGTAGG No data
1024910904_1024910907 15 Left 1024910904 7:54445652-54445674 CCTTCCTGCTTCTGCATAGTACA No data
Right 1024910907 7:54445690-54445712 TACAGCTCCCTACTTTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024910904 Original CRISPR TGTACTATGCAGAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr