ID: 1024910904 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:54445652-54445674 |
Sequence | TGTACTATGCAGAAGCAGGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1024910904_1024910911 | 28 | Left | 1024910904 | 7:54445652-54445674 | CCTTCCTGCTTCTGCATAGTACA | No data | ||
Right | 1024910911 | 7:54445703-54445725 | TTTGAGCAGGCATCTGTGTAGGG | No data | ||||
1024910904_1024910910 | 27 | Left | 1024910904 | 7:54445652-54445674 | CCTTCCTGCTTCTGCATAGTACA | No data | ||
Right | 1024910910 | 7:54445702-54445724 | CTTTGAGCAGGCATCTGTGTAGG | No data | ||||
1024910904_1024910907 | 15 | Left | 1024910904 | 7:54445652-54445674 | CCTTCCTGCTTCTGCATAGTACA | No data | ||
Right | 1024910907 | 7:54445690-54445712 | TACAGCTCCCTACTTTGAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1024910904 | Original CRISPR | TGTACTATGCAGAAGCAGGA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |