ID: 1024915136

View in Genome Browser
Species Human (GRCh38)
Location 7:54490621-54490643
Sequence CAGTGATAGTATTAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024915136_1024915144 9 Left 1024915136 7:54490621-54490643 CCCACCTCCTAATACTATCACTG No data
Right 1024915144 7:54490653-54490675 GGATTTCAGCACATTAATTTAGG No data
1024915136_1024915146 11 Left 1024915136 7:54490621-54490643 CCCACCTCCTAATACTATCACTG No data
Right 1024915146 7:54490655-54490677 ATTTCAGCACATTAATTTAGGGG No data
1024915136_1024915150 27 Left 1024915136 7:54490621-54490643 CCCACCTCCTAATACTATCACTG No data
Right 1024915150 7:54490671-54490693 TTAGGGGGGGCACAAATATTTGG No data
1024915136_1024915148 13 Left 1024915136 7:54490621-54490643 CCCACCTCCTAATACTATCACTG No data
Right 1024915148 7:54490657-54490679 TTCAGCACATTAATTTAGGGGGG No data
1024915136_1024915147 12 Left 1024915136 7:54490621-54490643 CCCACCTCCTAATACTATCACTG No data
Right 1024915147 7:54490656-54490678 TTTCAGCACATTAATTTAGGGGG No data
1024915136_1024915145 10 Left 1024915136 7:54490621-54490643 CCCACCTCCTAATACTATCACTG No data
Right 1024915145 7:54490654-54490676 GATTTCAGCACATTAATTTAGGG No data
1024915136_1024915149 14 Left 1024915136 7:54490621-54490643 CCCACCTCCTAATACTATCACTG No data
Right 1024915149 7:54490658-54490680 TCAGCACATTAATTTAGGGGGGG No data
1024915136_1024915151 28 Left 1024915136 7:54490621-54490643 CCCACCTCCTAATACTATCACTG No data
Right 1024915151 7:54490672-54490694 TAGGGGGGGCACAAATATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024915136 Original CRISPR CAGTGATAGTATTAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr