ID: 1024915145

View in Genome Browser
Species Human (GRCh38)
Location 7:54490654-54490676
Sequence GATTTCAGCACATTAATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024915137_1024915145 9 Left 1024915137 7:54490622-54490644 CCACCTCCTAATACTATCACTGT No data
Right 1024915145 7:54490654-54490676 GATTTCAGCACATTAATTTAGGG No data
1024915138_1024915145 6 Left 1024915138 7:54490625-54490647 CCTCCTAATACTATCACTGTAGG No data
Right 1024915145 7:54490654-54490676 GATTTCAGCACATTAATTTAGGG No data
1024915135_1024915145 11 Left 1024915135 7:54490620-54490642 CCCCACCTCCTAATACTATCACT No data
Right 1024915145 7:54490654-54490676 GATTTCAGCACATTAATTTAGGG No data
1024915133_1024915145 19 Left 1024915133 7:54490612-54490634 CCCAAGGTCCCCACCTCCTAATA No data
Right 1024915145 7:54490654-54490676 GATTTCAGCACATTAATTTAGGG No data
1024915136_1024915145 10 Left 1024915136 7:54490621-54490643 CCCACCTCCTAATACTATCACTG No data
Right 1024915145 7:54490654-54490676 GATTTCAGCACATTAATTTAGGG No data
1024915134_1024915145 18 Left 1024915134 7:54490613-54490635 CCAAGGTCCCCACCTCCTAATAC No data
Right 1024915145 7:54490654-54490676 GATTTCAGCACATTAATTTAGGG No data
1024915132_1024915145 30 Left 1024915132 7:54490601-54490623 CCTAATCATCTCCCAAGGTCCCC No data
Right 1024915145 7:54490654-54490676 GATTTCAGCACATTAATTTAGGG No data
1024915142_1024915145 3 Left 1024915142 7:54490628-54490650 CCTAATACTATCACTGTAGGGGT No data
Right 1024915145 7:54490654-54490676 GATTTCAGCACATTAATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024915145 Original CRISPR GATTTCAGCACATTAATTTA GGG Intergenic
No off target data available for this crispr