ID: 1024915151

View in Genome Browser
Species Human (GRCh38)
Location 7:54490672-54490694
Sequence TAGGGGGGGCACAAATATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024915136_1024915151 28 Left 1024915136 7:54490621-54490643 CCCACCTCCTAATACTATCACTG No data
Right 1024915151 7:54490672-54490694 TAGGGGGGGCACAAATATTTGGG No data
1024915138_1024915151 24 Left 1024915138 7:54490625-54490647 CCTCCTAATACTATCACTGTAGG No data
Right 1024915151 7:54490672-54490694 TAGGGGGGGCACAAATATTTGGG No data
1024915142_1024915151 21 Left 1024915142 7:54490628-54490650 CCTAATACTATCACTGTAGGGGT No data
Right 1024915151 7:54490672-54490694 TAGGGGGGGCACAAATATTTGGG No data
1024915135_1024915151 29 Left 1024915135 7:54490620-54490642 CCCCACCTCCTAATACTATCACT No data
Right 1024915151 7:54490672-54490694 TAGGGGGGGCACAAATATTTGGG No data
1024915137_1024915151 27 Left 1024915137 7:54490622-54490644 CCACCTCCTAATACTATCACTGT No data
Right 1024915151 7:54490672-54490694 TAGGGGGGGCACAAATATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024915151 Original CRISPR TAGGGGGGGCACAAATATTT GGG Intergenic
No off target data available for this crispr