ID: 1024919427

View in Genome Browser
Species Human (GRCh38)
Location 7:54542379-54542401
Sequence CCCGAGCCGGCTCCGTGTTT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024919416_1024919427 3 Left 1024919416 7:54542353-54542375 CCGCCCCGCTTGCCCACTCCCCA 0: 1
1: 0
2: 2
3: 66
4: 704
Right 1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1024919412_1024919427 21 Left 1024919412 7:54542335-54542357 CCCGGCGAAGTCCTCAGCCCGCC 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1024919411_1024919427 28 Left 1024919411 7:54542328-54542350 CCGCGAGCCCGGCGAAGTCCTCA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1024919417_1024919427 0 Left 1024919417 7:54542356-54542378 CCCCGCTTGCCCACTCCCCACTT 0: 1
1: 0
2: 2
3: 35
4: 333
Right 1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1024919419_1024919427 -2 Left 1024919419 7:54542358-54542380 CCGCTTGCCCACTCCCCACTTCC 0: 1
1: 1
2: 9
3: 130
4: 1025
Right 1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1024919413_1024919427 20 Left 1024919413 7:54542336-54542358 CCGGCGAAGTCCTCAGCCCGCCC 0: 1
1: 0
2: 2
3: 13
4: 123
Right 1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1024919415_1024919427 4 Left 1024919415 7:54542352-54542374 CCCGCCCCGCTTGCCCACTCCCC 0: 1
1: 0
2: 4
3: 73
4: 710
Right 1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1024919420_1024919427 -9 Left 1024919420 7:54542365-54542387 CCCACTCCCCACTTCCCGAGCCG 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1024919414_1024919427 10 Left 1024919414 7:54542346-54542368 CCTCAGCCCGCCCCGCTTGCCCA 0: 1
1: 0
2: 1
3: 40
4: 381
Right 1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1024919421_1024919427 -10 Left 1024919421 7:54542366-54542388 CCACTCCCCACTTCCCGAGCCGG 0: 1
1: 0
2: 2
3: 25
4: 323
Right 1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 38
1024919418_1024919427 -1 Left 1024919418 7:54542357-54542379 CCCGCTTGCCCACTCCCCACTTC 0: 1
1: 0
2: 8
3: 55
4: 667
Right 1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024919427 Original CRISPR CCCGAGCCGGCTCCGTGTTT AGG Exonic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
912555421 1:110512655-110512677 CCGGAGCCTGCTCCTTGTTGGGG + Intergenic
1063660783 10:8034239-8034261 CCCCAGCCAGCTCCGCGTCTTGG + Intergenic
1073196198 10:101694327-101694349 CCCGAGCCGGCCCCGCGTCCCGG - Intronic
1074765689 10:116698565-116698587 CCCGTGCCAGCTCCGTGTCTCGG - Intronic
1077176444 11:1193311-1193333 CCCGGGCCAGCTCGGTGTCTGGG + Intronic
1088626381 11:111733308-111733330 CCCGAGCCAGCACAGTGTCTGGG + Intronic
1101217840 12:102602833-102602855 CTAGAGCCTGCTCTGTGTTTAGG - Intergenic
1128980208 15:72180208-72180230 GCAGAGCCGGCTCTGTGATTTGG - Intronic
1131019942 15:89088975-89088997 CCCGAGAGGCCTCTGTGTTTCGG + Intronic
1133063914 16:3192730-3192752 CCCGGGCCGCCTCCGTGTCCCGG + Intergenic
1138944102 16:61826766-61826788 CCAGAGCCTGCTCCCTGTGTAGG - Intronic
1139470363 16:67174956-67174978 GCCAAGCCGGCTCAGGGTTTGGG - Intronic
1143449023 17:7024619-7024641 CCCGACCAGGCTCCCTGCTTGGG - Exonic
1148740650 17:49890641-49890663 CCCAAGCCGACCCCCTGTTTTGG + Intergenic
1151439170 17:74117091-74117113 GCCCAGCCGGCTGAGTGTTTAGG + Intergenic
1151492325 17:74440018-74440040 CCCCAGCAGGCTCCGTTTCTTGG - Exonic
1153672694 18:7427707-7427729 CCCCAGCCGGCTCCACGTTGGGG - Intergenic
1156888648 18:42164968-42164990 CCCAAGAGGGCTCCGTGTCTCGG - Intergenic
927054415 2:19356143-19356165 CCCGAACCCGCTCCGTGCCTGGG + Intronic
1176310860 21:5148107-5148129 CCCCAGTCGCCTCCGTGTTGGGG - Intronic
1179547818 21:42124351-42124373 CCCGTGCCGGCTCTGGGTTGGGG + Intronic
1179776897 21:43670432-43670454 ACCGAGCCTGCTGCGCGTTTGGG - Intronic
1179846195 21:44113928-44113950 CCCCAGTCGCCTCCGTGTTGGGG + Intronic
1183621409 22:38974991-38975013 CCAGTGCCAGCTCCCTGTTTAGG - Intronic
1184781925 22:46653980-46654002 CCCCAGCTGGCTCCGAATTTGGG + Intronic
950114846 3:10444190-10444212 CCCATGCCGACTCCGTGTCTGGG + Intronic
997582849 5:135028210-135028232 CTCGAGTCGGATCCGTGTTGGGG - Exonic
1001250187 5:170141161-170141183 TCCGAGCCAGCTCCTTGTATTGG + Intergenic
1003311650 6:4974248-4974270 CCAGAACCGGCTCTGAGTTTGGG - Intergenic
1007718286 6:43869960-43869982 CCCCAGCCGGCTCCCTGTGGTGG + Intergenic
1012608074 6:101182813-101182835 CCAGAGCCTGCTCCTTTTTTTGG + Intergenic
1017906334 6:158759511-158759533 CCCGGGACGGCTCTGTTTTTTGG + Intronic
1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG + Exonic
1029952475 7:104601790-104601812 CCAGAGCCAGCTCCAGGTTTTGG - Intronic
1040942338 8:52845861-52845883 CCCGGGCCAGCTCAGTGCTTTGG + Intergenic
1060815960 9:126635269-126635291 CCCGGGCCTGCTCCCTGTGTGGG - Intronic
1061828133 9:133274668-133274690 CCCGAGGCGCCTCCGCGTTTGGG + Intronic
1062683685 9:137799018-137799040 CCCGAGCTGGCTCTGTGCGTGGG - Intronic
1062683704 9:137799098-137799120 CCCGAGCTGGCTCTGTGTGTGGG - Intronic
1203688858 Un_GL000214v1:23368-23390 CCCGAGCCAGGTCCTTCTTTGGG + Intergenic
1203647417 Un_KI270751v1:80685-80707 CCCGAGCCAGGTCCTTCTTTGGG - Intergenic