ID: 1024919764

View in Genome Browser
Species Human (GRCh38)
Location 7:54544897-54544919
Sequence GTCACTCGCTTCCACAGAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024919764_1024919770 -2 Left 1024919764 7:54544897-54544919 CCGGTTCTGTGGAAGCGAGTGAC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1024919770 7:54544918-54544940 ACCCCCAGGGCTTCTAGGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 174
1024919764_1024919768 -6 Left 1024919764 7:54544897-54544919 CCGGTTCTGTGGAAGCGAGTGAC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1024919768 7:54544914-54544936 AGTGACCCCCAGGGCTTCTAGGG 0: 1
1: 0
2: 2
3: 8
4: 126
1024919764_1024919775 3 Left 1024919764 7:54544897-54544919 CCGGTTCTGTGGAAGCGAGTGAC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1024919775 7:54544923-54544945 CAGGGCTTCTAGGGAGGGAAAGG 0: 1
1: 2
2: 2
3: 28
4: 369
1024919764_1024919777 16 Left 1024919764 7:54544897-54544919 CCGGTTCTGTGGAAGCGAGTGAC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1024919777 7:54544936-54544958 GAGGGAAAGGGAATTTGTCCTGG 0: 1
1: 1
2: 2
3: 26
4: 286
1024919764_1024919776 4 Left 1024919764 7:54544897-54544919 CCGGTTCTGTGGAAGCGAGTGAC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1024919776 7:54544924-54544946 AGGGCTTCTAGGGAGGGAAAGGG 0: 1
1: 1
2: 1
3: 41
4: 339
1024919764_1024919769 -3 Left 1024919764 7:54544897-54544919 CCGGTTCTGTGGAAGCGAGTGAC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1024919769 7:54544917-54544939 GACCCCCAGGGCTTCTAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
1024919764_1024919767 -7 Left 1024919764 7:54544897-54544919 CCGGTTCTGTGGAAGCGAGTGAC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1024919767 7:54544913-54544935 GAGTGACCCCCAGGGCTTCTAGG 0: 1
1: 0
2: 1
3: 17
4: 180
1024919764_1024919778 17 Left 1024919764 7:54544897-54544919 CCGGTTCTGTGGAAGCGAGTGAC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1024919778 7:54544937-54544959 AGGGAAAGGGAATTTGTCCTGGG 0: 1
1: 0
2: 2
3: 27
4: 320
1024919764_1024919779 18 Left 1024919764 7:54544897-54544919 CCGGTTCTGTGGAAGCGAGTGAC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1024919779 7:54544938-54544960 GGGAAAGGGAATTTGTCCTGGGG 0: 1
1: 0
2: 2
3: 30
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024919764 Original CRISPR GTCACTCGCTTCCACAGAAC CGG (reversed) Intronic
900301641 1:1980905-1980927 GTCATCCGCAGCCACAGAACAGG - Intronic
901974130 1:12930812-12930834 GTCACTGGCTCCCACAGCAGTGG - Intronic
903389927 1:22956416-22956438 GTCACTCCCACACACAGAACTGG - Intronic
906644757 1:47466369-47466391 GTCACTCTATTCCCCAGAGCGGG + Intergenic
908938911 1:69409317-69409339 CTCACTCCAGTCCACAGAACTGG - Intergenic
912491192 1:110063742-110063764 TTCACTGGCTTGCACTGAACCGG - Intronic
913251667 1:116917081-116917103 GTCACATGCTGCTACAGAACTGG + Intronic
916343710 1:163764601-163764623 CTCACTCTCTTCCACAGCATTGG + Intergenic
918074265 1:181158654-181158676 GTTACCCTCATCCACAGAACAGG - Intergenic
918144648 1:181744820-181744842 TTCGTTCTCTTCCACAGAACAGG - Intronic
921962854 1:221054262-221054284 GCCAGTCTCTGCCACAGAACGGG + Intergenic
1077223514 11:1427580-1427602 GGCACACGCTCCCACAGAAATGG + Intronic
1081284002 11:41246002-41246024 CTCACTCGGGTCCACAGAACTGG + Intronic
1087227102 11:95613725-95613747 GTCTCTACCTTCCAGAGAACAGG - Intergenic
1088807602 11:113366533-113366555 GTTTCTAGCTTCTACAGAACAGG - Intronic
1094154596 12:27326295-27326317 GTCAGTGTCTTCCACAGCACGGG - Intergenic
1094239393 12:28204154-28204176 GTGACTCTCTTCTACAGCACTGG - Intronic
1097155791 12:57011381-57011403 TTCACTAGCTTCCAAAGAATTGG - Intronic
1098288400 12:68932692-68932714 GTCACTCACTTACACAGTATTGG - Exonic
1098468623 12:70818985-70819007 GTCACAATCTTCCACAGAAGAGG + Intronic
1101789091 12:107911799-107911821 CTCCCTCGCATCCACAGTACTGG - Intergenic
1102549845 12:113683848-113683870 GCCGCTCCCATCCACAGAACTGG + Intergenic
1106039881 13:26079734-26079756 GTCACACTCTTCCTCAGATCTGG - Intergenic
1106379537 13:29223171-29223193 CTCACTCCAGTCCACAGAACTGG - Intronic
1108498569 13:51047870-51047892 GTCACATCCTTCCAGAGAACAGG + Intergenic
1111474346 13:88725582-88725604 TTCACTCCAGTCCACAGAACTGG - Intergenic
1113397071 13:109957812-109957834 GTCACTCCCTTCCACAAAGCGGG - Intergenic
1115922219 14:38388360-38388382 GTGACTTGCTTCCATAGAATAGG + Intergenic
1120633266 14:86917837-86917859 GTCACTGGGTCCCACAGAATTGG + Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1124467408 15:29950638-29950660 GCCAGTCCCTTCCACAGAACTGG + Intronic
1132272292 15:100537080-100537102 GCCACTTGCTAACACAGAACTGG + Intronic
1132578429 16:674526-674548 GTCACTGCCTGCCACAGAACGGG + Intronic
1137692943 16:50441763-50441785 CCCACTCCCATCCACAGAACTGG - Intergenic
1140800016 16:78478474-78478496 TTCCCTCCCTTCCACAAAACAGG + Intronic
1142025249 16:87809379-87809401 ATCATTAGCTTCCACAAAACAGG + Intergenic
1157775208 18:50389108-50389130 GTCACTCCCATCCTCACAACAGG - Intronic
1159828673 18:73245843-73245865 TTCACTCTCTTTCTCAGAACTGG - Intronic
1160992981 19:1868228-1868250 GGGACTCGCTGCCGCAGAACAGG + Intergenic
1164724180 19:30454064-30454086 CTCACTTGCTTCCAAAGGACAGG + Intronic
1165382002 19:35488325-35488347 GTCACTCCCTCCCAGAGATCAGG + Intronic
1165957342 19:39509440-39509462 GTCACTCCCTACCACACAACAGG - Intergenic
1167254146 19:48417263-48417285 GCCACTTGCTTCCACAGAGTGGG - Intronic
927145955 2:20166756-20166778 GTTACTCACATCCACAGAGCAGG + Intergenic
929025880 2:37601117-37601139 GTCACTAGCAGCCACAAAACAGG - Intergenic
929486838 2:42362016-42362038 GTCACACGGTTTCTCAGAACTGG + Intronic
934334570 2:92114388-92114410 ATCACTCCCTTTCACAGAGCAGG + Intergenic
945304141 2:208242673-208242695 AACACTGGCTTCCACAGCACAGG - Intronic
947140708 2:227017134-227017156 GTTTCTCCCTTCCACTGAACAGG + Intronic
948545979 2:238729206-238729228 CCCACTGGCTTCCACAGCACAGG - Intergenic
948677171 2:239603544-239603566 GTCACTCTCTGTCACTGAACAGG + Intergenic
1168934215 20:1648910-1648932 GTCACCCCCTTCTACAGATCAGG - Intronic
1171600239 20:26740450-26740472 AACACTCCCTTTCACAGAACAGG + Intergenic
1171613039 20:26932509-26932531 AACACTCCCTTTCACAGAACAGG + Intergenic
1171614692 20:26957325-26957347 AACACTCGCTTTCACAGAGCAGG + Intergenic
1171631124 20:27203619-27203641 AACACTCCCTTTCACAGAACAGG + Intergenic
1171631777 20:27213475-27213497 AACACTCGCTTTCACAGAGCAGG + Intergenic
1171657305 20:27596018-27596040 AACACTCGCTTTCACAGAGCAGG + Intergenic
1171665277 20:27715497-27715519 AACACTCCCTTTCACAGAACAGG + Intergenic
1172392342 20:34574454-34574476 GTCCCTCTGTTCCACAGAGCAGG - Intronic
1177404331 21:20645870-20645892 CTCACTCTGGTCCACAGAACTGG - Intergenic
1183530481 22:38350806-38350828 GCCTCCTGCTTCCACAGAACAGG + Intronic
1202716904 2_KI270715v1_random:15892-15914 ATCACTCCCTTTCACAGAGCAGG + Intergenic
1202729219 2_KI270716v1_random:44400-44422 ATCACTCCCTTTCACAGAGCAGG + Intergenic
953895657 3:46797861-46797883 GTAACTTGCTTCCAAAGAATTGG + Intronic
954760709 3:52871539-52871561 GTCACTCTTTTCCACAAAAGAGG + Intronic
954785628 3:53090279-53090301 GTCCCTGGCATCCACAGAAAGGG - Exonic
957636352 3:82790748-82790770 CTCACTCAGGTCCACAGAACTGG - Intergenic
958002750 3:87772005-87772027 GTGCCTCGCTTTCACAGGACTGG - Intergenic
959037478 3:101383913-101383935 GTCACTCTGGTCCACGGAACTGG - Intronic
963022894 3:140889197-140889219 GTCAATGGCTTCCAAAGCACTGG + Intergenic
976647349 4:87399956-87399978 CTCACTCTGGTCCACAGAACTGG - Intergenic
977593060 4:98848444-98848466 GTCTCTGGCTTCCATAGAACAGG - Intergenic
981889208 4:149716009-149716031 CTCACTCTAGTCCACAGAACTGG + Intergenic
985079944 4:186254497-186254519 ATCACTCTCTTTCAAAGAACTGG - Intronic
985722089 5:1494691-1494713 CTCACTCACTTCCCCAGATCGGG + Exonic
985823960 5:2179304-2179326 ATTACTCTCTTCTACAGAACAGG + Intergenic
988346374 5:30042302-30042324 CTCACTCCAGTCCACAGAACTGG - Intergenic
988551860 5:32207462-32207484 GTCACTTGCTTCCAACAAACAGG - Intergenic
989217463 5:38920090-38920112 GTCTCTCCCTTCCTCAGAAGAGG - Intronic
994406558 5:99352637-99352659 TTCACTCCAGTCCACAGAACTGG + Intergenic
998685919 5:144524825-144524847 GTCTCTCCCTTCCACTGAATGGG - Intergenic
1002549007 5:179973226-179973248 ATCCCTCGCTTCCACAAAGCTGG + Intronic
1002763133 6:217330-217352 GTCACGCCCTTCCCCTGAACAGG + Intergenic
1003179849 6:3782198-3782220 GTCACTCTCTTCCCCAGACTTGG + Intergenic
1003386644 6:5673595-5673617 GTCCCTCACTTCCACAGAGCTGG - Intronic
1006391682 6:33762316-33762338 GTCACTCCTGTCCCCAGAACTGG + Intergenic
1019845805 7:3499760-3499782 GCCACTAACTTCCACAGAAGGGG - Intronic
1024547861 7:50537642-50537664 TTCACTCGCTTCCCCAGGGCAGG - Intronic
1024919764 7:54544897-54544919 GTCACTCGCTTCCACAGAACCGG - Intronic
1027520669 7:79202702-79202724 ATCACTTTCTTCCACAGAATTGG + Intronic
1030243796 7:107359566-107359588 GTCACTCCAGTCCGCAGAACTGG - Intronic
1035236206 7:157499161-157499183 CTCACTCACGTCCTCAGAACAGG - Intergenic
1038235997 8:25755776-25755798 GTGACTTGCTTCTAAAGAACAGG - Intergenic
1039570507 8:38582604-38582626 GTCATTCACTACCACAGGACTGG - Intergenic
1040573394 8:48628859-48628881 GTGACTCACTTCCAAAGAACAGG - Intergenic
1040995740 8:53400145-53400167 GTCAATCCCTGCCTCAGAACAGG - Intergenic
1042343130 8:67701456-67701478 GTCACTCGGTTCCACAGTCACGG - Intronic
1046775377 8:118158654-118158676 CTCACTCTGGTCCACAGAACTGG - Intergenic
1046885378 8:119361254-119361276 CTCCTTCGCTGCCACAGAACTGG + Intergenic
1053437512 9:38086254-38086276 GTCACTAGCTTTCACAGATAGGG + Intergenic
1060558583 9:124523576-124523598 GCCACTCTCCTCCATAGAACTGG - Intronic
1194947146 X:100082770-100082792 CTCACTCCATTCCAAAGAACTGG + Intergenic
1197807872 X:130414802-130414824 GTCACTGGCTACCACAGCAATGG - Intergenic
1198498255 X:137215542-137215564 GTCTCTGCCTTCCAGAGAACAGG + Intergenic